diff options
Diffstat (limited to 'doc/manual.html')
| -rw-r--r-- | doc/manual.html | 2108 |
1 files changed, 1759 insertions, 349 deletions
diff --git a/doc/manual.html b/doc/manual.html index f313cb6..498ebb9 100644 --- a/doc/manual.html +++ b/doc/manual.html @@ -8,10 +8,15 @@ <style> code{white-space: pre-wrap;} span.smallcaps{font-variant: small-caps;} - span.underline{text-decoration: underline;} - div.column{display: inline-block; vertical-align: top; width: 50%;} + div.columns{display: flex; gap: min(4vw, 1.5em);} + div.column{flex: auto; overflow-x: auto;} div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;} ul.task-list{list-style: none;} + ul.task-list li input[type="checkbox"] { + width: 0.8em; + margin: 0 0.8em 0.2em -1.6em; + vertical-align: middle; + } .display.math{display: block; text-align: center; margin: 0.5rem auto;} </style> <link rel="stylesheet" href="doc/style.css" /> @@ -26,91 +31,163 @@ </header> <nav id="TOC" role="doc-toc"> <ul> -<li><a href="#introduction">Introduction</a> +<li><a href="#introduction" id="toc-introduction">Introduction</a> <ul> -<li><a href="#how-is-bowtie-2-different-from-bowtie-1">How is Bowtie 2 different from Bowtie 1?</a></li> -<li><a href="#what-isnt-bowtie-2">What isn't Bowtie 2?</a></li> +<li><a href="#how-is-bowtie-2-different-from-bowtie-1" +id="toc-how-is-bowtie-2-different-from-bowtie-1">How is Bowtie 2 +different from Bowtie 1?</a></li> +<li><a href="#what-isnt-bowtie-2" id="toc-what-isnt-bowtie-2">What isn't +Bowtie 2?</a></li> </ul></li> -<li><a href="#obtaining-bowtie-2">Obtaining Bowtie 2</a> +<li><a href="#obtaining-bowtie-2" id="toc-obtaining-bowtie-2">Obtaining +Bowtie 2</a> <ul> -<li><a href="#building-from-source">Building from source</a></li> -<li><a href="#adding-to-path">Adding to PATH</a></li> +<li><a href="#building-from-source" +id="toc-building-from-source">Building from source</a></li> +<li><a href="#adding-to-path" id="toc-adding-to-path">Adding to +PATH</a></li> </ul></li> -<li><a href="#the-bowtie2-aligner">The <code>bowtie2</code> aligner</a> +<li><a href="#the-bowtie2-aligner" id="toc-the-bowtie2-aligner">The +<code>bowtie2</code> aligner</a> <ul> -<li><a href="#end-to-end-alignment-versus-local-alignment">End-to-end alignment versus local alignment</a> +<li><a href="#end-to-end-alignment-versus-local-alignment" +id="toc-end-to-end-alignment-versus-local-alignment">End-to-end +alignment versus local alignment</a> <ul> -<li><a href="#end-to-end-alignment-example">End-to-end alignment example</a></li> -<li><a href="#local-alignment-example">Local alignment example</a></li> +<li><a href="#end-to-end-alignment-example" +id="toc-end-to-end-alignment-example">End-to-end alignment +example</a></li> +<li><a href="#local-alignment-example" +id="toc-local-alignment-example">Local alignment example</a></li> </ul></li> -<li><a href="#scores-higher-more-similar">Scores: higher = more similar</a> +<li><a href="#scores-higher-more-similar" +id="toc-scores-higher-more-similar">Scores: higher = more similar</a> <ul> -<li><a href="#end-to-end-alignment-score-example">End-to-end alignment score example</a></li> -<li><a href="#local-alignment-score-example">Local alignment score example</a></li> -<li><a href="#valid-alignments-meet-or-exceed-the-minimum-score-threshold">Valid alignments meet or exceed the minimum score threshold</a></li> +<li><a href="#end-to-end-alignment-score-example" +id="toc-end-to-end-alignment-score-example">End-to-end alignment score +example</a></li> +<li><a href="#local-alignment-score-example" +id="toc-local-alignment-score-example">Local alignment score +example</a></li> +<li><a +href="#valid-alignments-meet-or-exceed-the-minimum-score-threshold" +id="toc-valid-alignments-meet-or-exceed-the-minimum-score-threshold">Valid +alignments meet or exceed the minimum score threshold</a></li> </ul></li> -<li><a href="#mapping-quality-higher-more-unique">Mapping quality: higher = more unique</a></li> -<li><a href="#aligning-pairs">Aligning pairs</a> +<li><a href="#mapping-quality-higher-more-unique" +id="toc-mapping-quality-higher-more-unique">Mapping quality: higher = +more unique</a></li> +<li><a href="#aligning-pairs" id="toc-aligning-pairs">Aligning pairs</a> <ul> -<li><a href="#paired-inputs">Paired inputs</a></li> -<li><a href="#paired-sam-output">Paired SAM output</a></li> -<li><a href="#concordant-pairs-match-pair-expectations-discordant-pairs-dont">Concordant pairs match pair expectations, discordant pairs don't</a></li> -<li><a href="#mixed-mode-paired-where-possible-unpaired-otherwise">Mixed mode: paired where possible, unpaired otherwise</a></li> -<li><a href="#some-sam-flags-describe-paired-end-properties">Some SAM FLAGS describe paired-end properties</a></li> -<li><a href="#some-sam-optional-fields-describe-more-paired-end-properties">Some SAM optional fields describe more paired-end properties</a></li> -<li><a href="#mates-can-overlap-contain-or-dovetail-each-other">Mates can overlap, contain, or dovetail each other</a></li> +<li><a href="#paired-inputs" id="toc-paired-inputs">Paired +inputs</a></li> +<li><a href="#paired-sam-output" id="toc-paired-sam-output">Paired SAM +output</a></li> +<li><a +href="#concordant-pairs-match-pair-expectations-discordant-pairs-dont" +id="toc-concordant-pairs-match-pair-expectations-discordant-pairs-dont">Concordant +pairs match pair expectations, discordant pairs don't</a></li> +<li><a href="#mixed-mode-paired-where-possible-unpaired-otherwise" +id="toc-mixed-mode-paired-where-possible-unpaired-otherwise">Mixed mode: +paired where possible, unpaired otherwise</a></li> +<li><a href="#some-sam-flags-describe-paired-end-properties" +id="toc-some-sam-flags-describe-paired-end-properties">Some SAM FLAGS +describe paired-end properties</a></li> +<li><a +href="#some-sam-optional-fields-describe-more-paired-end-properties" +id="toc-some-sam-optional-fields-describe-more-paired-end-properties">Some +SAM optional fields describe more paired-end properties</a></li> +<li><a href="#mates-can-overlap-contain-or-dovetail-each-other" +id="toc-mates-can-overlap-contain-or-dovetail-each-other">Mates can +overlap, contain, or dovetail each other</a></li> </ul></li> -<li><a href="#reporting">Reporting</a> +<li><a href="#reporting" id="toc-reporting">Reporting</a> <ul> -<li><a href="#distinct-alignments-map-a-read-to-different-places">Distinct alignments map a read to different places</a></li> -<li><a href="#default-mode-search-for-multiple-alignments-report-the-best-one">Default mode: search for multiple alignments, report the best one</a></li> -<li><a href="#k-mode-search-for-one-or-more-alignments-report-each">-k mode: search for one or more alignments, report each</a></li> -<li><a href="#a-mode-search-for-and-report-all-alignments">-a mode: search for and report all alignments</a></li> -<li><a href="#randomness-in-bowtie-2">Randomness in Bowtie 2</a></li> +<li><a href="#distinct-alignments-map-a-read-to-different-places" +id="toc-distinct-alignments-map-a-read-to-different-places">Distinct +alignments map a read to different places</a></li> +<li><a +href="#default-mode-search-for-multiple-alignments-report-the-best-one" +id="toc-default-mode-search-for-multiple-alignments-report-the-best-one">Default +mode: search for multiple alignments, report the best one</a></li> +<li><a href="#k-mode-search-for-one-or-more-alignments-report-each" +id="toc-k-mode-search-for-one-or-more-alignments-report-each">-k mode: +search for one or more alignments, report each</a></li> +<li><a href="#a-mode-search-for-and-report-all-alignments" +id="toc-a-mode-search-for-and-report-all-alignments">-a mode: search for +and report all alignments</a></li> +<li><a href="#randomness-in-bowtie-2" +id="toc-randomness-in-bowtie-2">Randomness in Bowtie 2</a></li> </ul></li> -<li><a href="#multiseed-heuristic">Multiseed heuristic</a> +<li><a href="#multiseed-heuristic" +id="toc-multiseed-heuristic">Multiseed heuristic</a> <ul> -<li><a href="#fm-index-memory-footprint">FM Index memory footprint</a></li> +<li><a href="#fm-index-memory-footprint" +id="toc-fm-index-memory-footprint">FM Index memory footprint</a></li> </ul></li> -<li><a href="#ambiguous-characters">Ambiguous characters</a></li> -<li><a href="#presets-setting-many-settings-at-once">Presets: setting many settings at once</a></li> -<li><a href="#filtering">Filtering</a></li> -<li><a href="#alignment-summary">Alignment summary</a></li> -<li><a href="#wrapper-scripts">Wrapper scripts</a></li> -<li><a href="#small-and-large-indexes">Small and large indexes</a></li> -<li><a href="#performance-tuning">Performance tuning</a></li> -<li><a href="#command-line">Command Line</a> +<li><a href="#ambiguous-characters" +id="toc-ambiguous-characters">Ambiguous characters</a></li> +<li><a href="#presets-setting-many-settings-at-once" +id="toc-presets-setting-many-settings-at-once">Presets: setting many +settings at once</a></li> +<li><a href="#filtering" id="toc-filtering">Filtering</a></li> +<li><a href="#alignment-summary" id="toc-alignment-summary">Alignment +summary</a></li> +<li><a href="#wrapper-scripts" id="toc-wrapper-scripts">Wrapper +scripts</a></li> +<li><a href="#small-and-large-indexes" +id="toc-small-and-large-indexes">Small and large indexes</a></li> +<li><a href="#performance-tuning" +id="toc-performance-tuning">Performance tuning</a></li> +<li><a href="#command-line" id="toc-command-line">Command Line</a> <ul> -<li><a href="#setting-function-options">Setting function options</a></li> -<li><a href="#usage">Usage</a></li> -<li><a href="#main-arguments">Main arguments</a></li> -<li><a href="#options">Options</a></li> +<li><a href="#setting-function-options" +id="toc-setting-function-options">Setting function options</a></li> +<li><a href="#usage" id="toc-usage">Usage</a></li> +<li><a href="#main-arguments" id="toc-main-arguments">Main +arguments</a></li> +<li><a href="#options" id="toc-options">Options</a></li> </ul></li> -<li><a href="#sam-output">SAM output</a></li> +<li><a href="#sam-output" id="toc-sam-output">SAM output</a></li> </ul></li> -<li><a href="#the-bowtie2-build-indexer">The <code>bowtie2-build</code> indexer</a> +<li><a href="#the-bowtie2-build-indexer" +id="toc-the-bowtie2-build-indexer">The <code>bowtie2-build</code> +indexer</a> <ul> -<li><a href="#command-line-1">Command Line</a> +<li><a href="#command-line-1" id="toc-command-line-1">Command Line</a> <ul> -<li><a href="#main-arguments-1">Main arguments</a></li> -<li><a href="#options-1">Options</a></li> +<li><a href="#main-arguments-1" id="toc-main-arguments-1">Main +arguments</a></li> +<li><a href="#options-1" id="toc-options-1">Options</a></li> </ul></li> </ul></li> -<li><a href="#the-bowtie2-inspect-index-inspector">The <code>bowtie2-inspect</code> index inspector</a> +<li><a href="#the-bowtie2-inspect-index-inspector" +id="toc-the-bowtie2-inspect-index-inspector">The +<code>bowtie2-inspect</code> index inspector</a> <ul> -<li><a href="#command-line-2">Command Line</a> +<li><a href="#command-line-2" id="toc-command-line-2">Command Line</a> <ul> -<li><a href="#main-arguments-2">Main arguments</a></li> -<li><a href="#options-2">Options</a></li> +<li><a href="#main-arguments-2" id="toc-main-arguments-2">Main +arguments</a></li> +<li><a href="#options-2" id="toc-options-2">Options</a></li> </ul></li> </ul></li> -<li><a href="#getting-started-with-bowtie-2-lambda-phage-example">Getting started with Bowtie 2: Lambda phage example</a> +<li><a href="#getting-started-with-bowtie-2-lambda-phage-example" +id="toc-getting-started-with-bowtie-2-lambda-phage-example">Getting +started with Bowtie 2: Lambda phage example</a> <ul> -<li><a href="#indexing-a-reference-genome">Indexing a reference genome</a></li> -<li><a href="#aligning-example-reads">Aligning example reads</a></li> -<li><a href="#paired-end-example">Paired-end example</a></li> -<li><a href="#local-alignment-example-1">Local alignment example</a></li> -<li><a href="#using-samtoolsbcftools-downstream">Using SAMtools/BCFtools downstream</a></li> +<li><a href="#indexing-a-reference-genome" +id="toc-indexing-a-reference-genome">Indexing a reference +genome</a></li> +<li><a href="#aligning-example-reads" +id="toc-aligning-example-reads">Aligning example reads</a></li> +<li><a href="#paired-end-example" id="toc-paired-end-example">Paired-end +example</a></li> +<li><a href="#local-alignment-example-1" +id="toc-local-alignment-example-1">Local alignment example</a></li> +<li><a href="#using-samtoolsbcftools-downstream" +id="toc-using-samtoolsbcftools-downstream">Using SAMtools/BCFtools +downstream</a></li> </ul></li> </ul> </nav> @@ -120,58 +197,204 @@ ! of this text document, or see the HTML manual online. ! --> <h1 id="introduction">Introduction</h1> -<p><a href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an <a href="http://en.wikipedia.org/wiki/FM-index">FM Index</a> (based on the <a href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler Transform</a> or <a href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">BWT</a>) to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 gigabytes of RAM. Bowtie 2 supports gapped, local, and paired-end alignment modes. Multiple processors can be used simultaneously to achieve greater alignment speed.</p> -<p>Bowtie 2 outputs alignments in <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> format, enabling interoperation with a large number of other tools (e.g. <a href="http://samtools.sourceforge.net">SAMtools</a>, <a href="http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit">GATK</a>) that use SAM. Bowtie 2 is distributed under the <a href="http://www.gnu.org/licenses/gpl-3.0.html">GPLv3 license</a>, and it runs on the command line under Windows, Mac OS X and Linux and BSD.</p> -<p><a href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> is often the first step in pipelines for comparative genomics, including for variation calling, ChIP-seq, RNA-seq, BS-seq. <a href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> and <a href="http://bowtie-bio.sf.net">Bowtie</a> (also called "<a href="http://bowtie-bio.sf.net">Bowtie 1</a>" here) are also tightly integrated into many other tools, some of which <a href="http://bowtie-bio.sourceforge.net/bowtie2/other_tools.shtml">are listed here</a>.</p> -<p>If you use <a href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> for your published research, please cite our work. Papers describing Bowtie 2 are:</p> +<p><a href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> is an +ultrafast and memory-efficient tool for aligning sequencing reads to +long reference sequences. It is particularly good at aligning reads of +about 50 up to 100s of characters to relatively long (e.g. mammalian) +genomes. Bowtie 2 indexes the genome with an <a +href="http://en.wikipedia.org/wiki/FM-index">FM Index</a> (based on the +<a +href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler +Transform</a> or <a +href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">BWT</a>) +to keep its memory footprint small: for the human genome, its memory +footprint is typically around 3.2 gigabytes of RAM. Bowtie 2 supports +gapped, local, and paired-end alignment modes. Multiple processors can +be used simultaneously to achieve greater alignment speed.</p> +<p>Bowtie 2 outputs alignments in <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> format, enabling +interoperation with a large number of other tools (e.g. <a +href="http://samtools.sourceforge.net">SAMtools</a>, <a +href="http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit">GATK</a>) +that use SAM. Bowtie 2 is distributed under the <a +href="http://www.gnu.org/licenses/gpl-3.0.html">GPLv3 license</a>, and +it runs on the command line under Windows, Mac OS X and Linux and +BSD.</p> +<p><a href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> is often the +first step in pipelines for comparative genomics, including for +variation calling, ChIP-seq, RNA-seq, BS-seq. <a +href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> and <a +href="http://bowtie-bio.sf.net">Bowtie</a> (also called "<a +href="http://bowtie-bio.sf.net">Bowtie 1</a>" here) are also tightly +integrated into many other tools, some of which <a +href="http://bowtie-bio.sourceforge.net/bowtie2/other_tools.shtml">are +listed here</a>.</p> +<p>If you use <a href="http://bowtie-bio.sf.net/bowtie2">Bowtie 2</a> +for your published research, please cite our work. Papers describing +Bowtie 2 are:</p> <ul> -<li><p>Langmead B, Wilks C, Antonescu V, Charles R. <a href="https://doi.org/10.1093/bioinformatics/bty648">Scaling read aligners to hundreds of threads on general-purpose processors</a>. <em>Bioinformatics</em>. 2018 Jul 18. doi: 10.1093/bioinformatics/bty648.</p></li> -<li><p>Langmead B, Salzberg SL. <a href="https://www.nature.com/articles/nmeth.1923">Fast gapped-read alignment with Bowtie 2</a>. <em>Nature Methods</em>. 2012 Mar 4;9(4):357-9. doi: 10.1038/nmeth.1923.</p></li> +<li><p>Langmead B, Wilks C, Antonescu V, Charles R. <a +href="https://doi.org/10.1093/bioinformatics/bty648">Scaling read +aligners to hundreds of threads on general-purpose processors</a>. +<em>Bioinformatics</em>. 2018 Jul 18. doi: +10.1093/bioinformatics/bty648.</p></li> +<li><p>Langmead B, Salzberg SL. <a +href="https://www.nature.com/articles/nmeth.1923">Fast gapped-read +alignment with Bowtie 2</a>. <em>Nature Methods</em>. 2012 Mar +4;9(4):357-9. doi: 10.1038/nmeth.1923.</p></li> </ul> -<h2 id="how-is-bowtie-2-different-from-bowtie-1">How is Bowtie 2 different from Bowtie 1?</h2> -<p>Bowtie 1 was released in 2009 and was geared toward aligning the relatively short sequencing reads (up to 25-50 nucleotides) prevalent at the time. Since then, technology has improved both sequencing throughput (more nucleotides produced per sequencer per day) and read length (more nucleotides per read).</p> +<h2 id="how-is-bowtie-2-different-from-bowtie-1">How is Bowtie 2 +different from Bowtie 1?</h2> +<p>Bowtie 1 was released in 2009 and was geared toward aligning the +relatively short sequencing reads (up to 25-50 nucleotides) prevalent at +the time. Since then, technology has improved both sequencing throughput +(more nucleotides produced per sequencer per day) and read length (more +nucleotides per read).</p> <p>The chief differences between Bowtie 1 and Bowtie 2 are:</p> <ol type="1"> -<li><p>For reads longer than about 50 bp Bowtie 2 is generally faster, more sensitive, and uses less memory than Bowtie 1. For relatively short reads (e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or more sensitive.</p></li> -<li><p>Bowtie 2 supports gapped alignment with affine gap penalties. Number of gaps and gap lengths are not restricted, except by way of the configurable scoring scheme. Bowtie 1 finds just ungapped alignments.</p></li> -<li><p>Bowtie 2 supports <a href="#end-to-end-alignment-versus-local-alignment">local alignment</a>, which doesn't require reads to align end-to-end. Local alignments might be "trimmed" ("soft clipped") at one or both extremes in a way that optimizes alignment score. Bowtie 2 also supports <a href="#end-to-end-alignment-versus-local-alignment">end-to-end alignment</a> which, like Bowtie 1, requires that the read align entirely.</p></li> -<li><p>There is no upper limit on read length in Bowtie 2. Bowtie 1 had an upper limit of around 1000 bp.</p></li> -<li><p>Bowtie 2 allows alignments to <a href="#ambiguous-characters">overlap ambiguous characters</a> (e.g. <code>N</code>s) in the reference. Bowtie 1 does not.</p></li> -<li><p>Bowtie 2 does away with Bowtie 1's notion of alignment "stratum", and its distinction between "Maq-like" and "end-to-end" modes. In Bowtie 2 all alignments lie along a continuous spectrum of alignment scores where the <a href="#scores-higher-more-similar">scoring scheme</a>, similar to <a href="http://en.wikipedia.org/wiki/Needleman-Wunsch_algorithm">Needleman-Wunsch</a> and <a href="http://en.wikipedia.org/wiki/Smith_waterman">Smith-Waterman</a>.</p></li> -<li><p>Bowtie 2's <a href="#aligning-pairs">paired-end alignment</a> is more flexible. E.g. for pairs that do not align in a paired fashion, Bowtie 2 attempts to find unpaired alignments for each mate.</p></li> -<li><p>Bowtie 2 reports a spectrum of mapping qualities, in contrast for Bowtie 1 which reports either 0 or high.</p></li> +<li><p>For reads longer than about 50 bp Bowtie 2 is generally faster, +more sensitive, and uses less memory than Bowtie 1. For relatively short +reads (e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or more +sensitive.</p></li> +<li><p>Bowtie 2 supports gapped alignment with affine gap penalties. +Number of gaps and gap lengths are not restricted, except by way of the +configurable scoring scheme. Bowtie 1 finds just ungapped +alignments.</p></li> +<li><p>Bowtie 2 supports <a +href="#end-to-end-alignment-versus-local-alignment">local alignment</a>, +which doesn't require reads to align end-to-end. Local alignments might +be "trimmed" ("soft clipped") at one or both extremes in a way that +optimizes alignment score. Bowtie 2 also supports <a +href="#end-to-end-alignment-versus-local-alignment">end-to-end +alignment</a> which, like Bowtie 1, requires that the read align +entirely.</p></li> +<li><p>There is no upper limit on read length in Bowtie 2. Bowtie 1 had +an upper limit of around 1000 bp.</p></li> +<li><p>Bowtie 2 allows alignments to <a +href="#ambiguous-characters">overlap ambiguous characters</a> (e.g. +<code>N</code>s) in the reference. Bowtie 1 does not.</p></li> +<li><p>Bowtie 2 does away with Bowtie 1's notion of alignment "stratum", +and its distinction between "Maq-like" and "end-to-end" modes. In Bowtie +2 all alignments lie along a continuous spectrum of alignment scores +where the <a href="#scores-higher-more-similar">scoring scheme</a>, +similar to <a +href="http://en.wikipedia.org/wiki/Needleman-Wunsch_algorithm">Needleman-Wunsch</a> +and <a +href="http://en.wikipedia.org/wiki/Smith_waterman">Smith-Waterman</a>.</p></li> +<li><p>Bowtie 2's <a href="#aligning-pairs">paired-end alignment</a> is +more flexible. E.g. for pairs that do not align in a paired fashion, +Bowtie 2 attempts to find unpaired alignments for each mate.</p></li> +<li><p>Bowtie 2 reports a spectrum of mapping qualities, in contrast for +Bowtie 1 which reports either 0 or high.</p></li> <li><p>Bowtie 2 does not align colorspace reads.</p></li> </ol> -<p>Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's command-line arguments and genome index format are both different from Bowtie 1's.</p> +<p>Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's +command-line arguments and genome index format are both different from +Bowtie 1's.</p> <h2 id="what-isnt-bowtie-2">What isn't Bowtie 2?</h2> -<p>Bowtie 2 is geared toward aligning relatively short sequencing reads to long genomes. That said, it handles arbitrarily small reference sequences (e.g. amplicons) and very long reads (i.e. upwards of 10s or 100s of kilobases), though it is slower in those settings. It is optimized for the read lengths and error modes yielded by typical Illumina sequencers.</p> -<p>Bowtie 2 does not support alignment of colorspace reads. (Bowtie 1 does.)</p> +<p>Bowtie 2 is geared toward aligning relatively short sequencing reads +to long genomes. That said, it handles arbitrarily small reference +sequences (e.g. amplicons) and very long reads (i.e. upwards of 10s or +100s of kilobases), though it is slower in those settings. It is +optimized for the read lengths and error modes yielded by typical +Illumina sequencers.</p> +<p>Bowtie 2 does not support alignment of colorspace reads. (Bowtie 1 +does.)</p> <h1 id="obtaining-bowtie-2">Obtaining Bowtie 2</h1> -<p>Bowtie 2 is available from various package managers, notably <a href="https://anaconda.org/bioconda/bowtie2">Bioconda</a>. With Bioconda installed, you should be able to install Bowtie 2 with <code>conda install bowtie2</code>.</p> -<p>Containerized versions of Bowtie 2 are also available via the <a href="https://BioContainers.pro">Biocontainers</a> project (e.g. <a href="https://hub.docker.com/r/biocontainers/bowtie2/">via Docker Hub</a>).</p> -<p>You can also download Bowtie 2 sources and binaries from the <a href="https://sourceforge.net/projects/bowtie-bio/files/bowtie2/">Download</a> section of the Sourceforge site. Binaries are available for the <code>x86_64</code> architecture running Linux, Mac OS X, and Windows. FreeBSD users can obtain the latest version of Bowtie 2 from ports using <code>pkg install bowtie2</code>. If you plan to compile Bowtie 2 yourself, make sure to get the source package, i.e., the filename that ends in "-source.zip".</p> +<p>Bowtie 2 is available from various package managers, notably <a +href="https://anaconda.org/bioconda/bowtie2">Bioconda</a>. With Bioconda +installed, you should be able to install Bowtie 2 with +<code>conda install bowtie2</code>.</p> +<p>You can also download Bowtie 2 sources and binaries from the <a +href="https://sourceforge.net/projects/bowtie-bio/files/bowtie2/">Download</a> +section of the Sourceforge site. Binaries are available for the +<code>x86_64</code> architecture running Linux, Mac OS X, and Windows. +FreeBSD users can obtain the latest version of Bowtie 2 from ports using +<code>pkg install bowtie2</code>. If you plan to compile Bowtie 2 +yourself, make sure to get the source package, i.e., the filename that +ends in "-source.zip".</p> <h2 id="building-from-source">Building from source</h2> <p>Building from source</p> -<p>Building Bowtie 2 from source requires a GNU-like environment with Clang/GCC, GNU Make and other basics. It should be possible to build Bowtie 2 on most vanilla *NIX installations or on a Mac installation with Xcode installed. Bowtie 2 can also be built on Windows using a 64-bit MinGW distribution and MSYS. In order to simplify the MinGW setup it might be worth investigating popular MinGW personal builds since these are coming already prepared with most of the toolchains needed.</p> -<p>First, download the source package from the <a href="https://sourceforge.net/projects/bowtie-bio/files/bowtie2/">sourceforge site</a>. Make sure you're getting the source package; the file downloaded should end in <code>-source.zip</code>. Unzip the file, change to the unzipped directory, and build the Bowtie 2 tools by running GNU <code>make</code> (usually with the command <code>make</code>, but sometimes with <code>gmake</code>) with no arguments. If building with MinGW, run <code>make</code> from the MSYS environment.</p> -<p>The Bowtie 2 Makefile also includes recipes for basic automatic dependency management. Running <code>make static-libs && make STATIC_BUILD=1</code> will issue a series of commands that will: 1. download zstd and zlib 2. compile them as static libraries 3. link the resulting libraries to the compiled Bowtie 2 binaries</p> -<p>As of version 2.3.5 bowtie2 now supports aligning SRA reads. Prepackaged builds will include a package that supports SRA. If you're building bowtie2 from source please make sure that the Java runtime is available on your system. You can then proceed with the build by running <code>make sra-deps && make USE_SRA=1</code>.</p> +<p>Building Bowtie 2 from source requires a GNU-like environment with +Clang/GCC, GNU Make and other basics. It should be possible to build +Bowtie 2 on most vanilla *NIX installations or on a Mac installation +with Xcode installed. Bowtie 2 can also be built on Windows using a +64-bit MinGW distribution and MSYS. In order to simplify the MinGW setup +it might be worth investigating popular MinGW personal builds since +these are coming already prepared with most of the toolchains +needed.</p> +<p>First, download the source package from the <a +href="https://sourceforge.net/projects/bowtie-bio/files/bowtie2/">sourceforge +site</a>. Make sure you're getting the source package; the file +downloaded should end in <code>-source.zip</code>. Unzip the file, +change to the unzipped directory, and build the Bowtie 2 tools by +running GNU <code>make</code> (usually with the command +<code>make</code>, but sometimes with <code>gmake</code>) with no +arguments. If building with MinGW, run <code>make</code> from the MSYS +environment.</p> +<p>The Bowtie 2 Makefile also includes recipes for basic automatic +dependency management. Running +<code>make static-libs && make STATIC_BUILD=1</code> will issue +a series of commands that will: 1. download zstd and zlib 2. compile +them as static libraries 3. link the resulting libraries to the compiled +Bowtie 2 binaries</p> +<p>As of version 2.3.5 bowtie2 now supports aligning SRA reads. +Prepackaged builds will include a package that supports SRA. If you're +building bowtie2 from source please make sure that the Java runtime is +available on your system. You can then proceed with the build by running +<code>make sra-deps && make USE_SRA=1</code>.</p> <h2 id="adding-to-path">Adding to PATH</h2> -<p>By adding your new Bowtie 2 directory to your <a href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH environment variable</a>, you ensure that whenever you run <code>bowtie2</code>, <code>bowtie2-build</code> or <code>bowtie2-inspect</code> from the command line, you will get the version you just installed without having to specify the entire path. This is recommended for most users. To do this, follow your operating system's instructions for adding the directory to your <a href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH</a>.</p> -<p>If you would like to install Bowtie 2 by copying the Bowtie 2 executable files to an existing directory in your <a href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH</a>, make sure that you copy all the executables, including <code>bowtie2</code>, <code>bowtie2-align-s</code>, <code>bowtie2-align-l</code>, <code>bowtie2-build</code>, <code>bowtie2-build-s</code>, <code>bowtie2-build-l</code>, <code>bowtie2-inspect</code>, <code>bowtie2-inspect-s</code> and <code>bowtie2-inspect-l</code>.</p> +<p>By adding your new Bowtie 2 directory to your <a +href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH environment +variable</a>, you ensure that whenever you run <code>bowtie2</code>, +<code>bowtie2-build</code> or <code>bowtie2-inspect</code> from the +command line, you will get the version you just installed without having +to specify the entire path. This is recommended for most users. To do +this, follow your operating system's instructions for adding the +directory to your <a +href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH</a>.</p> +<p>If you would like to install Bowtie 2 by copying the Bowtie 2 +executable files to an existing directory in your <a +href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH</a>, make sure +that you copy all the executables, including <code>bowtie2</code>, +<code>bowtie2-align-s</code>, <code>bowtie2-align-l</code>, +<code>bowtie2-build</code>, <code>bowtie2-build-s</code>, +<code>bowtie2-build-l</code>, <code>bowtie2-inspect</code>, +<code>bowtie2-inspect-s</code> and <code>bowtie2-inspect-l</code>.</p> <h1 id="the-bowtie2-aligner">The <code>bowtie2</code> aligner</h1> -<p><code>bowtie2</code> takes a Bowtie 2 index and a set of sequencing read files and outputs a set of alignments in SAM format.</p> -<p>"Alignment" is the process by which we discover how and where the read sequences are similar to the reference sequence. An "alignment" is a result from this process, specifically: an alignment is a way of "lining up" some or all of the characters in the read with some characters from the reference in a way that reveals how they're similar. For example:</p> +<p><code>bowtie2</code> takes a Bowtie 2 index and a set of sequencing +read files and outputs a set of alignments in SAM format.</p> +<p>"Alignment" is the process by which we discover how and where the +read sequences are similar to the reference sequence. An "alignment" is +a result from this process, specifically: an alignment is a way of +"lining up" some or all of the characters in the read with some +characters from the reference in a way that reveals how they're similar. +For example:</p> <pre><code> Read: GACTGGGCGATCTCGACTTCG ||||| |||||||||| ||| Reference: GACTG--CGATCTCGACATCG</code></pre> -<p>Where dash symbols represent gaps and vertical bars show where aligned characters match.</p> -<p>We use alignment to make an educated guess as to where a read originated with respect to the reference genome. It's not always possible to determine this with certainty. For instance, if the reference genome contains several long stretches of As (<code>AAAAAAAAA</code> etc.) and the read sequence is a short stretch of As (<code>AAAAAAA</code>), we cannot know for certain exactly where in the sea of <code>A</code>s the read originated.</p> -<h2 id="end-to-end-alignment-versus-local-alignment">End-to-end alignment versus local alignment</h2> -<p>By default, Bowtie 2 performs end-to-end read alignment. That is, it searches for alignments involving all of the read characters. This is also called an "untrimmed" or "unclipped" alignment.</p> -<p>When the --local option is specified, Bowtie 2 performs local read alignment. In this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both ends of the alignment if doing so maximizes the alignment score.</p> +<p>Where dash symbols represent gaps and vertical bars show where +aligned characters match.</p> +<p>We use alignment to make an educated guess as to where a read +originated with respect to the reference genome. It's not always +possible to determine this with certainty. For instance, if the +reference genome contains several long stretches of As +(<code>AAAAAAAAA</code> etc.) and the read sequence is a short stretch +of As (<code>AAAAAAA</code>), we cannot know for certain exactly where +in the sea of <code>A</code>s the read originated.</p> +<h2 id="end-to-end-alignment-versus-local-alignment">End-to-end +alignment versus local alignment</h2> +<p>By default, Bowtie 2 performs end-to-end read alignment. That is, it +searches for alignments involving all of the read characters. This is +also called an "untrimmed" or "unclipped" alignment.</p> +<p>When the --local option is specified, Bowtie 2 performs local read +alignment. In this mode, Bowtie 2 might "trim" or "clip" some read +characters from one or both ends of the alignment if doing so maximizes +the alignment score.</p> <h3 id="end-to-end-alignment-example">End-to-end alignment example</h3> -<p>The following is an "end-to-end" alignment because it involves all the characters in the read. Such an alignment can be produced by Bowtie 2 in either end-to-end mode or in local mode.</p> +<p>The following is an "end-to-end" alignment because it involves all +the characters in the read. Such an alignment can be produced by Bowtie +2 in either end-to-end mode or in local mode.</p> <pre><code>Read: GACTGGGCGATCTCGACTTCG Reference: GACTGCGATCTCGACATCG @@ -180,7 +403,11 @@ Alignment: ||||| |||||||||| ||| Reference: GACTG--CGATCTCGACATCG</code></pre> <h3 id="local-alignment-example">Local alignment example</h3> -<p>The following is a "local" alignment because some of the characters at the ends of the read do not participate. In this case, 4 characters are omitted (or "soft trimmed" or "soft clipped") from the beginning and 3 characters are omitted from the end. This sort of alignment can be produced by Bowtie 2 only in local mode.</p> +<p>The following is a "local" alignment because some of the characters +at the ends of the read do not participate. In this case, 4 characters +are omitted (or "soft trimmed" or "soft clipped") from the beginning and +3 characters are omitted from the end. This sort of alignment can be +produced by Bowtie 2 only in local mode.</p> <pre><code>Read: ACGGTTGCGTTAATCCGCCACG Reference: TAACTTGCGTTAAATCCGCCTGG @@ -189,47 +416,204 @@ Alignment: ||||||||| |||||| Reference: TAACTTGCGTTAAATCCGCCTGG</code></pre> <h2 id="scores-higher-more-similar">Scores: higher = more similar</h2> -<p>An alignment score quantifies how similar the read sequence is to the reference sequence aligned to. The higher the score, the more similar they are. A score is calculated by subtracting penalties for each difference (mismatch, gap, etc.) and, in local alignment mode, adding bonuses for each match.</p> -<p>The scores can be configured with the <a href="#bowtie2-options-ma"><code>--ma</code></a> (match bonus), <a href="#bowtie2-options-mp"><code>--mp</code></a> (mismatch penalty), <a href="#bowtie2-options-np"><code>--np</code></a> (penalty for having an N in either the read or the reference), <a href="#bowtie2-options-rdg"><code>--rdg</code></a> (affine read gap penalty) and <a href="#bowtie2-options-rfg"><code>--rfg</code></a> (affine reference gap penalty) options.</p> -<h3 id="end-to-end-alignment-score-example">End-to-end alignment score example</h3> -<p>A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). Thus, in end-to-end alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score is -(6 + 11) = -17.</p> -<p>The best possible alignment score in end-to-end mode is 0, which happens when there are no differences between the read and the reference.</p> -<h3 id="local-alignment-score-example">Local alignment score example</h3> -<p>A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). A base that matches receives a bonus of +2 be default. Thus, in local alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score equals the total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.</p> -<p>The best possible score in local mode equals the match bonus times the length of the read. This happens when there are no differences between the read and the reference.</p> -<h3 id="valid-alignments-meet-or-exceed-the-minimum-score-threshold">Valid alignments meet or exceed the minimum score threshold</h3> -<p>For an alignment to be considered "valid" (i.e. "good enough") by Bowtie 2, it must have an alignment score no less than the minimum score threshold. The threshold is configurable and is expressed as a function of the read length. In end-to-end alignment mode, the default minimum score threshold is <code>-0.6 + -0.6 * L</code>, where <code>L</code> is the read length. In local alignment mode, the default minimum score threshold is <code>20 + 8.0 * ln(L)</code>, where L is the read length. This can be configured with the <a href="#bowtie2-options-score-min"><code>--score-min</code></a> option. For details on how to set options like <code>--score-min</code> that correspond to functions, see the section on <a href="#setting-function-options">setting function options</a>.</p> -<h2 id="mapping-quality-higher-more-unique">Mapping quality: higher = more unique</h2> -<p>The aligner cannot always assign a read to its point of origin with high confidence. For instance, a read that originated inside a repeat element might align equally well to many occurrences of the element throughout the genome, leaving the aligner with no basis for preferring one over the others.</p> -<p>Aligners characterize their degree of confidence in the point of origin by reporting a mapping quality: a non-negative integer Q = -10 log10 p, where p is an estimate of the probability that the alignment does not correspond to the read's true point of origin. Mapping quality is sometimes abbreviated MAPQ, and is recorded in the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> <code>MAPQ</code> field.</p> -<p>Mapping quality is related to "uniqueness." We say an alignment is unique if it has a much higher alignment score than all the other possible alignments. The bigger the gap between the best alignment's score and the second-best alignment's score, the more unique the best alignment, and the higher its mapping quality should be.</p> -<p>Accurate mapping qualities are useful for downstream tools like variant callers. For instance, a variant caller might choose to ignore evidence from alignments with mapping quality less than, say, 10. A mapping quality of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere.</p> +<p>An alignment score quantifies how similar the read sequence is to the +reference sequence aligned to. The higher the score, the more similar +they are. A score is calculated by subtracting penalties for each +difference (mismatch, gap, etc.) and, in local alignment mode, adding +bonuses for each match.</p> +<p>The scores can be configured with the <a +href="#bowtie2-options-ma"><code>--ma</code></a> (match bonus), <a +href="#bowtie2-options-mp"><code>--mp</code></a> (mismatch penalty), <a +href="#bowtie2-options-np"><code>--np</code></a> (penalty for having an +N in either the read or the reference), <a +href="#bowtie2-options-rdg"><code>--rdg</code></a> (affine read gap +penalty) and <a href="#bowtie2-options-rfg"><code>--rfg</code></a> +(affine reference gap penalty) options.</p> +<h3 id="end-to-end-alignment-score-example">End-to-end alignment score +example</h3> +<p>A mismatched base at a high-quality position in the read receives a +penalty of -6 by default. A length-2 read gap receives a penalty of -11 +by default (-5 for the gap open, -3 for the first extension, -3 for the +second extension). Thus, in end-to-end alignment mode, if the read is 50 +bp long and it matches the reference exactly except for one mismatch at +a high-quality position and one length-2 read gap, then the overall +score is -(6 + 11) = -17.</p> +<p>The best possible alignment score in end-to-end mode is 0, which +happens when there are no differences between the read and the +reference.</p> +<h3 id="local-alignment-score-example">Local alignment score +example</h3> +<p>A mismatched base at a high-quality position in the read receives a +penalty of -6 by default. A length-2 read gap receives a penalty of -11 +by default (-5 for the gap open, -3 for the first extension, -3 for the +second extension). A base that matches receives a bonus of +2 be +default. Thus, in local alignment mode, if the read is 50 bp long and it +matches the reference exactly except for one mismatch at a high-quality +position and one length-2 read gap, then the overall score equals the +total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.</p> +<p>The best possible score in local mode equals the match bonus times +the length of the read. This happens when there are no differences +between the read and the reference.</p> +<h3 +id="valid-alignments-meet-or-exceed-the-minimum-score-threshold">Valid +alignments meet or exceed the minimum score threshold</h3> +<p>For an alignment to be considered "valid" (i.e. "good enough") by +Bowtie 2, it must have an alignment score no less than the minimum score +threshold. The threshold is configurable and is expressed as a function +of the read length. In end-to-end alignment mode, the default minimum +score threshold is <code>-0.6 + -0.6 * L</code>, where <code>L</code> is +the read length. In local alignment mode, the default minimum score +threshold is <code>20 + 8.0 * ln(L)</code>, where L is the read length. +This can be configured with the <a +href="#bowtie2-options-score-min"><code>--score-min</code></a> option. +For details on how to set options like <code>--score-min</code> that +correspond to functions, see the section on <a +href="#setting-function-options">setting function options</a>.</p> +<h2 id="mapping-quality-higher-more-unique">Mapping quality: higher = +more unique</h2> +<p>The aligner cannot always assign a read to its point of origin with +high confidence. For instance, a read that originated inside a repeat +element might align equally well to many occurrences of the element +throughout the genome, leaving the aligner with no basis for preferring +one over the others.</p> +<p>Aligners characterize their degree of confidence in the point of +origin by reporting a mapping quality: a non-negative integer Q = -10 +log10 p, where p is an estimate of the probability that the alignment +does not correspond to the read's true point of origin. Mapping quality +is sometimes abbreviated MAPQ, and is recorded in the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> +<code>MAPQ</code> field.</p> +<p>Mapping quality is related to "uniqueness." We say an alignment is +unique if it has a much higher alignment score than all the other +possible alignments. The bigger the gap between the best alignment's +score and the second-best alignment's score, the more unique the best +alignment, and the higher its mapping quality should be.</p> +<p>Accurate mapping qualities are useful for downstream tools like +variant callers. For instance, a variant caller might choose to ignore +evidence from alignments with mapping quality less than, say, 10. A +mapping quality of 10 or less indicates that there is at least a 1 in 10 +chance that the read truly originated elsewhere.</p> <h2 id="aligning-pairs">Aligning pairs</h2> -<p>A "paired-end" or "mate-pair" read consists of pair of mates, called mate 1 and mate 2. Pairs come with a prior expectation about (a) the relative orientation of the mates, and (b) the distance separating them on the original DNA molecule. Exactly what expectations hold for a given dataset depends on the lab procedures used to generate the data. For example, a common lab procedure for producing pairs is Illumina's Paired-end Sequencing Assay, which yields pairs with a relative orientation of FR ("forward, reverse") meaning that if mate 1 came from the Watson strand, mate 2 very likely came from the Crick strand and vice versa. Also, this protocol yields pairs where the expected genomic distance from end to end is about 200-500 base pairs.</p> -<p>For simplicity, this manual uses the term "paired-end" to refer to any pair of reads with some expected relative orientation and distance. Depending on the protocol, these might actually be referred to as "paired-end" or "mate-paired." Also, we always refer to the individual sequences making up the pair as "mates."</p> +<p>A "paired-end" or "mate-pair" read consists of pair of mates, called +mate 1 and mate 2. Pairs come with a prior expectation about (a) the +relative orientation of the mates, and (b) the distance separating them +on the original DNA molecule. Exactly what expectations hold for a given +dataset depends on the lab procedures used to generate the data. For +example, a common lab procedure for producing pairs is Illumina's +Paired-end Sequencing Assay, which yields pairs with a relative +orientation of FR ("forward, reverse") meaning that if mate 1 came from +the Watson strand, mate 2 very likely came from the Crick strand and +vice versa. Also, this protocol yields pairs where the expected genomic +distance from end to end is about 200-500 base pairs.</p> +<p>For simplicity, this manual uses the term "paired-end" to refer to +any pair of reads with some expected relative orientation and distance. +Depending on the protocol, these might actually be referred to as +"paired-end" or "mate-paired." Also, we always refer to the individual +sequences making up the pair as "mates."</p> <h3 id="paired-inputs">Paired inputs</h3> -<p>Pairs are often stored in a pair of files, one file containing the mate 1s and the other containing the mates 2s. The first mate in the file for mate 1 forms a pair with the first mate in the file for mate 2, the second with the second, and so on. When aligning pairs with Bowtie 2, specify the file with the mate 1s mates using the <a href="#bowtie2-options-1"><code>-1</code></a> argument and the file with the mate 2s using the <a href="#bowtie2-options-2"><code>-2</code></a> argument. This causes Bowtie 2 to take the paired nature of the reads into account when aligning them.</p> +<p>Pairs are often stored in a pair of files, one file containing the +mate 1s and the other containing the mates 2s. The first mate in the +file for mate 1 forms a pair with the first mate in the file for mate 2, +the second with the second, and so on. When aligning pairs with Bowtie +2, specify the file with the mate 1s mates using the <a +href="#bowtie2-options-1"><code>-1</code></a> argument and the file with +the mate 2s using the <a href="#bowtie2-options-2"><code>-2</code></a> +argument. This causes Bowtie 2 to take the paired nature of the reads +into account when aligning them.</p> <h3 id="paired-sam-output">Paired SAM output</h3> -<p>When Bowtie 2 prints a SAM alignment for a pair, it prints two records (i.e. two lines of output), one for each mate. The first record describes the alignment for mate 1 and the second record describes the alignment for mate 2. In both records, some of the fields of the SAM record describe various properties of the alignment; for instance, the 7th and 8th fields (<code>RNEXT</code> and <code>PNEXT</code> respectively) indicate the reference name and position where the other mate aligned, and the 9th field indicates the inferred length of the DNA fragment from which the two mates were sequenced. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for more details regarding these fields.</p> -<h3 id="concordant-pairs-match-pair-expectations-discordant-pairs-dont">Concordant pairs match pair expectations, discordant pairs don't</h3> -<p>A pair that aligns with the expected relative mate orientation and with the expected range of distances between mates is said to align "concordantly". If both mates have unique alignments, but the alignments do not match paired-end expectations (i.e. the mates aren't in the expected relative orientation, or aren't within the expected distance range, or both), the pair is said to align "discordantly". Discordant alignments may be of particular interest, for instance, when seeking <a href="http://www.ncbi.nlm.nih.gov/dbvar/content/overview/">structural variants</a>.</p> -<p>The expected relative orientation of the mates is set using the <a href="#bowtie2-options-fr"><code>--ff</code></a>, <a href="#bowtie2-options-fr"><code>--fr</code></a>, or <a href="#bowtie2-options-fr"><code>--rf</code></a> options. The expected range of inter-mates distances (as measured from the furthest extremes of the mates; also called "outer distance") is set with the <a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a> options. Note that setting <a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a> far apart makes Bowtie 2 slower. See documentation for <a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a>.</p> -<p>To declare that a pair aligns discordantly, Bowtie 2 requires that both mates align uniquely. This is a conservative threshold, but this is often desirable when seeking structural variants.</p> -<p>By default, Bowtie 2 searches for both concordant and discordant alignments, though searching for discordant alignments can be disabled with the <a href="#bowtie2-options-no-discordant"><code>--no-discordant</code></a> option.</p> -<h3 id="mixed-mode-paired-where-possible-unpaired-otherwise">Mixed mode: paired where possible, unpaired otherwise</h3> -<p>If Bowtie 2 cannot find a paired-end alignment for a pair, by default it will go on to look for unpaired alignments for the constituent mates. This is called "mixed mode." To disable mixed mode, set the <a href="#bowtie2-options-no-mixed"><code>--no-mixed</code></a> option.</p> -<p>Bowtie 2 runs a little faster in <code>--no-mixed</code> mode, but will only consider alignment status of pairs per se, not individual mates.</p> -<h3 id="some-sam-flags-describe-paired-end-properties">Some SAM FLAGS describe paired-end properties</h3> -<p>The SAM <code>FLAGS</code> field, the second field in a SAM record, has multiple bits that describe the paired-end nature of the read and alignment. The first (least significant) bit (1 in decimal, 0x1 in hexadecimal) is set if the read is part of a pair. The second bit (2 in decimal, 0x2 in hexadecimal) is set if the read is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in hexadecimal) is set if the read is part of a pair and the other mate in the pair had at least one valid alignment. The sixth bit (32 in decimal, 0x20 in hexadecimal) is set if the read is part of a pair and the other mate in the pair aligned to the Crick strand (or, equivalently, if the reverse complement of the other mate aligned to the Watson strand). The seventh bit (64 in decimal, 0x40 in hexadecimal) is set if the read is mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexadecimal) is set if the read is mate 2 in a pair. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for a more detailed description of the <code>FLAGS</code> field.</p> -<h3 id="some-sam-optional-fields-describe-more-paired-end-properties">Some SAM optional fields describe more paired-end properties</h3> -<p>The last several fields of each SAM record usually contain SAM optional fields, which are simply tab-separated strings conveying additional information about the reads and alignments. A SAM optional field is formatted like this: "XP:i:1" where "XP" is the <code>TAG</code>, "i" is the <code>TYPE</code> ("integer" in this case), and "1" is the <code>VALUE</code>. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for details regarding SAM optional fields.</p> -<h3 id="mates-can-overlap-contain-or-dovetail-each-other">Mates can overlap, contain, or dovetail each other</h3> -<p>The fragment and read lengths might be such that alignments for the two mates from a pair overlap each other. Consider this example:</p> -<p>(For these examples, assume we expect mate 1 to align to the left of mate 2.)</p> +<p>When Bowtie 2 prints a SAM alignment for a pair, it prints two +records (i.e. two lines of output), one for each mate. The first record +describes the alignment for mate 1 and the second record describes the +alignment for mate 2. In both records, some of the fields of the SAM +record describe various properties of the alignment; for instance, the +7th and 8th fields (<code>RNEXT</code> and <code>PNEXT</code> +respectively) indicate the reference name and position where the other +mate aligned, and the 9th field indicates the inferred length of the DNA +fragment from which the two mates were sequenced. See the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> +for more details regarding these fields.</p> +<h3 +id="concordant-pairs-match-pair-expectations-discordant-pairs-dont">Concordant +pairs match pair expectations, discordant pairs don't</h3> +<p>A pair that aligns with the expected relative mate orientation and +with the expected range of distances between mates is said to align +"concordantly". If both mates have unique alignments, but the alignments +do not match paired-end expectations (i.e. the mates aren't in the +expected relative orientation, or aren't within the expected distance +range, or both), the pair is said to align "discordantly". Discordant +alignments may be of particular interest, for instance, when seeking <a +href="http://www.ncbi.nlm.nih.gov/dbvar/content/overview/">structural +variants</a>.</p> +<p>The expected relative orientation of the mates is set using the <a +href="#bowtie2-options-fr"><code>--ff</code></a>, <a +href="#bowtie2-options-fr"><code>--fr</code></a>, or <a +href="#bowtie2-options-fr"><code>--rf</code></a> options. The expected +range of inter-mates distances (as measured from the furthest extremes +of the mates; also called "outer distance") is set with the <a +href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a> options. Note that setting +<a href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a> far apart makes Bowtie 2 +slower. See documentation for <a +href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a>.</p> +<p>To declare that a pair aligns discordantly, Bowtie 2 requires that +both mates align uniquely. This is a conservative threshold, but this is +often desirable when seeking structural variants.</p> +<p>By default, Bowtie 2 searches for both concordant and discordant +alignments, though searching for discordant alignments can be disabled +with the <a +href="#bowtie2-options-no-discordant"><code>--no-discordant</code></a> +option.</p> +<h3 id="mixed-mode-paired-where-possible-unpaired-otherwise">Mixed mode: +paired where possible, unpaired otherwise</h3> +<p>If Bowtie 2 cannot find a paired-end alignment for a pair, by default +it will go on to look for unpaired alignments for the constituent mates. +This is called "mixed mode." To disable mixed mode, set the <a +href="#bowtie2-options-no-mixed"><code>--no-mixed</code></a> option.</p> +<p>Bowtie 2 runs a little faster in <code>--no-mixed</code> mode, but +will only consider alignment status of pairs per se, not individual +mates.</p> +<h3 id="some-sam-flags-describe-paired-end-properties">Some SAM FLAGS +describe paired-end properties</h3> +<p>The SAM <code>FLAGS</code> field, the second field in a SAM record, +has multiple bits that describe the paired-end nature of the read and +alignment. The first (least significant) bit (1 in decimal, 0x1 in +hexadecimal) is set if the read is part of a pair. The second bit (2 in +decimal, 0x2 in hexadecimal) is set if the read is part of a pair that +aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in +hexadecimal) is set if the read is part of a pair and the other mate in +the pair had at least one valid alignment. The sixth bit (32 in decimal, +0x20 in hexadecimal) is set if the read is part of a pair and the other +mate in the pair aligned to the Crick strand (or, equivalently, if the +reverse complement of the other mate aligned to the Watson strand). The +seventh bit (64 in decimal, 0x40 in hexadecimal) is set if the read is +mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexadecimal) +is set if the read is mate 2 in a pair. See the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> +for a more detailed description of the <code>FLAGS</code> field.</p> +<h3 +id="some-sam-optional-fields-describe-more-paired-end-properties">Some +SAM optional fields describe more paired-end properties</h3> +<p>The last several fields of each SAM record usually contain SAM +optional fields, which are simply tab-separated strings conveying +additional information about the reads and alignments. A SAM optional +field is formatted like this: "XP:i:1" where "XP" is the +<code>TAG</code>, "i" is the <code>TYPE</code> ("integer" in this case), +and "1" is the <code>VALUE</code>. See the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> +for details regarding SAM optional fields.</p> +<h3 id="mates-can-overlap-contain-or-dovetail-each-other">Mates can +overlap, contain, or dovetail each other</h3> +<p>The fragment and read lengths might be such that alignments for the +two mates from a pair overlap each other. Consider this example:</p> +<p>(For these examples, assume we expect mate 1 to align to the left of +mate 2.)</p> <pre><code>Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTT Mate 2: TGTTTGGGGTGACACATTACGCGTCTTTGAC Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pre> -<p>It's also possible, though unusual, for one mate alignment to contain the other, as in these examples:</p> +<p>It's also possible, though unusual, for one mate alignment to contain +the other, as in these examples:</p> <pre><code>Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC Mate 2: TGTTTGGGGTGACACATTACGC Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC @@ -237,64 +621,269 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC Mate 1: CAGCTACGATATTGTTTGGGGTGACACATTACGC Mate 2: CTACGATATTGTTTGGGGTGAC Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pre> -<p>And it's also possible, though unusual, for the mates to "dovetail", with the mates seemingly extending "past" each other as in this example:</p> +<p>And it's also possible, though unusual, for the mates to "dovetail", +with the mates seemingly extending "past" each other as in this +example:</p> <pre><code>Mate 1: GTCAGCTACGATATTGTTTGGGGTGACACATTACGC Mate 2: TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pre> -<p>In some situations, it's desirable for the aligner to consider all these cases as "concordant" as long as other paired-end constraints are not violated. Bowtie 2's default behavior is to consider overlapping and containing as being consistent with concordant alignment. By default, dovetailing is considered inconsistent with concordant alignment.</p> -<p>These defaults can be overridden. Setting <a href="#bowtie2-options-no-overlap"><code>--no-overlap</code></a> causes Bowtie 2 to consider overlapping mates as non-concordant. Setting <a href="#bowtie2-options-no-contain"><code>--no-contain</code></a> causes Bowtie 2 to consider cases where one mate alignment contains the other as non-concordant. Setting <a href="#bowtie2-options-dovetail"><code>--dovetail</code></a> causes Bowtie 2 to consider cases where the mate alignments dovetail as concordant.</p> +<p>In some situations, it's desirable for the aligner to consider all +these cases as "concordant" as long as other paired-end constraints are +not violated. Bowtie 2's default behavior is to consider overlapping and +containing as being consistent with concordant alignment. By default, +dovetailing is considered inconsistent with concordant alignment.</p> +<p>These defaults can be overridden. Setting <a +href="#bowtie2-options-no-overlap"><code>--no-overlap</code></a> causes +Bowtie 2 to consider overlapping mates as non-concordant. Setting <a +href="#bowtie2-options-no-contain"><code>--no-contain</code></a> causes +Bowtie 2 to consider cases where one mate alignment contains the other +as non-concordant. Setting <a +href="#bowtie2-options-dovetail"><code>--dovetail</code></a> causes +Bowtie 2 to consider cases where the mate alignments dovetail as +concordant.</p> <h2 id="reporting">Reporting</h2> -<p>The reporting mode governs how many alignments Bowtie 2 looks for, and how to report them. Bowtie 2 has three distinct reporting modes. The default reporting mode is similar to the default reporting mode of many other read alignment tools, including <a href="http://bio-bwa.sourceforge.net/">BWA</a>. It is also similar to Bowtie 1's <code>-M</code> alignment mode.</p> -<p>In general, when we say that a read has an alignment, we mean that it has a <a href="#valid-alignments-meet-or-exceed-the-minimum-score-threshold">valid alignment</a>. When we say that a read has multiple alignments, we mean that it has multiple alignments that are valid and distinct from one another.</p> -<h3 id="distinct-alignments-map-a-read-to-different-places">Distinct alignments map a read to different places</h3> -<p>Two alignments for the same individual read are "distinct" if they map the same read to different places. Specifically, we say that two alignments are distinct if there are no alignment positions where a particular read offset is aligned opposite a particular reference offset in both alignments with the same orientation. E.g. if the first alignment is in the forward orientation and aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, and the second alignment is also in the forward orientation and also aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, they are not distinct alignments.</p> -<p>Two alignments for the same pair are distinct if either the mate 1s in the two paired-end alignments are distinct or the mate 2s in the two alignments are distinct or both.</p> -<h3 id="default-mode-search-for-multiple-alignments-report-the-best-one">Default mode: search for multiple alignments, report the best one</h3> -<p>By default, Bowtie 2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it generally will continue to look for alignments that are nearly as good or better. It will eventually stop looking, either because it exceeded a limit placed on search effort (see <a href="#bowtie2-options-D"><code>-D</code></a> and <a href="#bowtie2-options-R"><code>-R</code></a>) or because it already knows all it needs to know to report an alignment. Information from the best alignments are used to estimate mapping quality (the <code>MAPQ</code> <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> field) and to set SAM optional fields, such as <a href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a> and <a href="#bowtie2-build-opt-fields-xs"><code>XS:i</code></a>. Bowtie 2 does not guarantee that the alignment reported is the best possible in terms of alignment score.</p> -<p>See also: <a href="#bowtie2-options-D"><code>-D</code></a>, which puts an upper limit on the number of dynamic programming problems (i.e. seed extensions) that can "fail" in a row before Bowtie 2 stops searching. Increasing <a href="#bowtie2-options-D"><code>-D</code></a> makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.</p> -<p>See also: <a href="#bowtie2-options-R"><code>-R</code></a>, which sets the maximum number of times Bowtie 2 will "re-seed" when attempting to align a read with repetitive seeds. Increasing <a href="#bowtie2-options-R"><code>-R</code></a> makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.</p> -<h3 id="k-mode-search-for-one-or-more-alignments-report-each">-k mode: search for one or more alignments, report each</h3> -<p>In <a href="#bowtie2-options-k"><code>-k</code></a> mode, Bowtie 2 searches for up to N distinct, valid alignments for each read, where N equals the integer specified with the <code>-k</code> parameter. That is, if <code>-k 2</code> is specified, Bowtie 2 will search for at most 2 distinct alignments. It reports all alignments found, in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. Supplementary alignments will also be assigned a MAPQ of 255. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for details.</p> -<p>Bowtie 2 does not "find" alignments in any specific order, so for reads that have more than N distinct, valid alignments, Bowtie 2 does not guarantee that the N alignments reported are the best possible in terms of alignment score. Still, this mode can be effective and fast in situations where the user cares more about whether a read aligns (or aligns a certain number of times) than where exactly it originated.</p> -<h3 id="a-mode-search-for-and-report-all-alignments">-a mode: search for and report all alignments</h3> -<p><a href="#bowtie2-options-a"><code>-a</code></a> mode is similar to <a href="#bowtie2-options-k"><code>-k</code></a> mode except that there is no upper limit on the number of alignments Bowtie 2 should report. Alignments are reported in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. Supplementary alignments will be assigned a MAPQ of 255. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for details.</p> -<p>Some tools are designed with this reporting mode in mind. Bowtie 2 is not! For very large genomes, this mode is very slow.</p> +<p>The reporting mode governs how many alignments Bowtie 2 looks for, +and how to report them. Bowtie 2 has three distinct reporting modes. The +default reporting mode is similar to the default reporting mode of many +other read alignment tools, including <a +href="http://bio-bwa.sourceforge.net/">BWA</a>. It is also similar to +Bowtie 1's <code>-M</code> alignment mode.</p> +<p>In general, when we say that a read has an alignment, we mean that it +has a <a +href="#valid-alignments-meet-or-exceed-the-minimum-score-threshold">valid +alignment</a>. When we say that a read has multiple alignments, we mean +that it has multiple alignments that are valid and distinct from one +another.</p> +<h3 id="distinct-alignments-map-a-read-to-different-places">Distinct +alignments map a read to different places</h3> +<p>Two alignments for the same individual read are "distinct" if they +map the same read to different places. Specifically, we say that two +alignments are distinct if there are no alignment positions where a +particular read offset is aligned opposite a particular reference offset +in both alignments with the same orientation. E.g. if the first +alignment is in the forward orientation and aligns the read character at +read offset 10 to the reference character at chromosome 3, offset +3,445,245, and the second alignment is also in the forward orientation +and also aligns the read character at read offset 10 to the reference +character at chromosome 3, offset 3,445,245, they are not distinct +alignments.</p> +<p>Two alignments for the same pair are distinct if either the mate 1s +in the two paired-end alignments are distinct or the mate 2s in the two +alignments are distinct or both.</p> +<h3 +id="default-mode-search-for-multiple-alignments-report-the-best-one">Default +mode: search for multiple alignments, report the best one</h3> +<p>By default, Bowtie 2 searches for distinct, valid alignments for each +read. When it finds a valid alignment, it generally will continue to +look for alignments that are nearly as good or better. It will +eventually stop looking, either because it exceeded a limit placed on +search effort (see <a href="#bowtie2-options-D"><code>-D</code></a> and +<a href="#bowtie2-options-R"><code>-R</code></a>) or because it already +knows all it needs to know to report an alignment. Information from the +best alignments are used to estimate mapping quality (the +<code>MAPQ</code> <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> field) and to +set SAM optional fields, such as <a +href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a> and <a +href="#bowtie2-build-opt-fields-xs"><code>XS:i</code></a>. Bowtie 2 does +not guarantee that the alignment reported is the best possible in terms +of alignment score.</p> +<p>See also: <a href="#bowtie2-options-D"><code>-D</code></a>, which +puts an upper limit on the number of dynamic programming problems (i.e. +seed extensions) that can "fail" in a row before Bowtie 2 stops +searching. Increasing <a href="#bowtie2-options-D"><code>-D</code></a> +makes Bowtie 2 slower, but increases the likelihood that it will report +the correct alignment for a read that aligns many places.</p> +<p>See also: <a href="#bowtie2-options-R"><code>-R</code></a>, which +sets the maximum number of times Bowtie 2 will "re-seed" when attempting +to align a read with repetitive seeds. Increasing <a +href="#bowtie2-options-R"><code>-R</code></a> makes Bowtie 2 slower, but +increases the likelihood that it will report the correct alignment for a +read that aligns many places.</p> +<h3 id="k-mode-search-for-one-or-more-alignments-report-each">-k mode: +search for one or more alignments, report each</h3> +<p>In <a href="#bowtie2-options-k"><code>-k</code></a> mode, Bowtie 2 +searches for up to N distinct, valid alignments for each read, where N +equals the integer specified with the <code>-k</code> parameter. That +is, if <code>-k 2</code> is specified, Bowtie 2 will search for at most +2 distinct alignments. It reports all alignments found, in descending +order by alignment score. The alignment score for a paired-end alignment +equals the sum of the alignment scores of the individual mates. Each +reported read or pair alignment beyond the first has the SAM 'secondary' +bit (which equals 256) set in its FLAGS field. Supplementary alignments +will also be assigned a MAPQ of 255. See the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> +for details.</p> +<p>Bowtie 2 does not "find" alignments in any specific order, so for +reads that have more than N distinct, valid alignments, Bowtie 2 does +not guarantee that the N alignments reported are the best possible in +terms of alignment score. Still, this mode can be effective and fast in +situations where the user cares more about whether a read aligns (or +aligns a certain number of times) than where exactly it originated.</p> +<h3 id="a-mode-search-for-and-report-all-alignments">-a mode: search for +and report all alignments</h3> +<p><a href="#bowtie2-options-a"><code>-a</code></a> mode is similar to +<a href="#bowtie2-options-k"><code>-k</code></a> mode except that there +is no upper limit on the number of alignments Bowtie 2 should report. +Alignments are reported in descending order by alignment score. The +alignment score for a paired-end alignment equals the sum of the +alignment scores of the individual mates. Each reported read or pair +alignment beyond the first has the SAM 'secondary' bit (which equals +256) set in its FLAGS field. Supplementary alignments will be assigned a +MAPQ of 255. See the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> +for details.</p> +<p>Some tools are designed with this reporting mode in mind. Bowtie 2 is +not! For very large genomes, this mode is very slow.</p> <h3 id="randomness-in-bowtie-2">Randomness in Bowtie 2</h3> -<p>Bowtie 2's search for alignments for a given read is "randomized." That is, when Bowtie 2 encounters a set of equally-good choices, it uses a pseudo-random number to choose. For example, if Bowtie 2 discovers a set of 3 equally-good alignments and wants to decide which to report, it picks a pseudo-random integer 0, 1 or 2 and reports the corresponding alignment. Arbitrary choices can crop up at various points during alignment.</p> -<p>The pseudo-random number generator is re-initialized for every read, and the seed used to initialize it is a function of the read name, nucleotide string, quality string, and the value specified with <a href="#bowtie2-options-seed"><code>--seed</code></a>. If you run the same version of Bowtie 2 on two reads with identical names, nucleotide strings, and quality strings, and if <a href="#bowtie2-options-seed"><code>--seed</code></a> is set the same for both runs, Bowtie 2 will produce the same output; i.e., it will align the read to the same place, even if there are multiple equally good alignments. This is intuitive and desirable in most cases. Most users expect Bowtie to produce the same output when run twice on the same input.</p> -<p>However, when the user specifies the <a href="#bowtie2-options-non-deterministic"><code>--non-deterministic</code></a> option, Bowtie 2 will use the current time to re-initialize the pseudo-random number generator. When this is specified, Bowtie 2 might report different alignments for identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads.</p> +<p>Bowtie 2's search for alignments for a given read is "randomized." +That is, when Bowtie 2 encounters a set of equally-good choices, it uses +a pseudo-random number to choose. For example, if Bowtie 2 discovers a +set of 3 equally-good alignments and wants to decide which to report, it +picks a pseudo-random integer 0, 1 or 2 and reports the corresponding +alignment. Arbitrary choices can crop up at various points during +alignment.</p> +<p>The pseudo-random number generator is re-initialized for every read, +and the seed used to initialize it is a function of the read name, +nucleotide string, quality string, and the value specified with <a +href="#bowtie2-options-seed"><code>--seed</code></a>. If you run the +same version of Bowtie 2 on two reads with identical names, nucleotide +strings, and quality strings, and if <a +href="#bowtie2-options-seed"><code>--seed</code></a> is set the same for +both runs, Bowtie 2 will produce the same output; i.e., it will align +the read to the same place, even if there are multiple equally good +alignments. This is intuitive and desirable in most cases. Most users +expect Bowtie to produce the same output when run twice on the same +input.</p> +<p>However, when the user specifies the <a +href="#bowtie2-options-non-deterministic"><code>--non-deterministic</code></a> +option, Bowtie 2 will use the current time to re-initialize the +pseudo-random number generator. When this is specified, Bowtie 2 might +report different alignments for identical reads. This is +counter-intuitive for some users, but might be more appropriate in +situations where the input consists of many identical reads.</p> <h2 id="multiseed-heuristic">Multiseed heuristic</h2> -<p>To rapidly narrow the number of possible alignments that must be considered, Bowtie 2 begins by extracting substrings ("seeds") from the read and its reverse complement and aligning them in an ungapped fashion with the help of the <a href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a>. This is "multiseed alignment" and it is similar to what <a href="http://genomebiology.com/2009/10/3/R25">Bowtie 1 does</a>, except Bowtie 1 attempts to align the entire read this way.</p> -<p>This initial step makes Bowtie 2 much faster than it would be without such a filter, but at the expense of missing some valid alignments. For instance, it is possible for a read to have a valid overall alignment but to have no valid seed alignments because each potential seed alignment is interrupted by too many mismatches or gaps.</p> -<p>The trade-off between speed and sensitivity/accuracy can be adjusted by setting the seed length (<a href="#bowtie2-options-L"><code>-L</code></a>), the interval between extracted seeds (<a href="#bowtie2-options-i"><code>-i</code></a>), and the number of mismatches permitted per seed (<a href="#bowtie2-options-N"><code>-N</code></a>). For more sensitive alignment, set these parameters to (a) make the seeds closer together, (b) make the seeds shorter, and/or (c) allow more mismatches. You can adjust these options one-by-one, though Bowtie 2 comes with some useful combinations of options prepackaged as "<a href="#presets-setting-many-settings-at-once">preset options</a>."</p> -<p><a href="#bowtie2-options-D"><code>-D</code></a> and <a href="#bowtie2-options-R"><code>-R</code></a> are also options that adjust the trade-off between speed and sensitivity/accuracy.</p> +<p>To rapidly narrow the number of possible alignments that must be +considered, Bowtie 2 begins by extracting substrings ("seeds") from the +read and its reverse complement and aligning them in an ungapped fashion +with the help of the <a +href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a>. This +is "multiseed alignment" and it is similar to what <a +href="http://genomebiology.com/2009/10/3/R25">Bowtie 1 does</a>, except +Bowtie 1 attempts to align the entire read this way.</p> +<p>This initial step makes Bowtie 2 much faster than it would be without +such a filter, but at the expense of missing some valid alignments. For +instance, it is possible for a read to have a valid overall alignment +but to have no valid seed alignments because each potential seed +alignment is interrupted by too many mismatches or gaps.</p> +<p>The trade-off between speed and sensitivity/accuracy can be adjusted +by setting the seed length (<a +href="#bowtie2-options-L"><code>-L</code></a>), the interval between +extracted seeds (<a href="#bowtie2-options-i"><code>-i</code></a>), and +the number of mismatches permitted per seed (<a +href="#bowtie2-options-N"><code>-N</code></a>). For more sensitive +alignment, set these parameters to (a) make the seeds closer together, +(b) make the seeds shorter, and/or (c) allow more mismatches. You can +adjust these options one-by-one, though Bowtie 2 comes with some useful +combinations of options prepackaged as "<a +href="#presets-setting-many-settings-at-once">preset options</a>."</p> +<p><a href="#bowtie2-options-D"><code>-D</code></a> and <a +href="#bowtie2-options-R"><code>-R</code></a> are also options that +adjust the trade-off between speed and sensitivity/accuracy.</p> <h3 id="fm-index-memory-footprint">FM Index memory footprint</h3> -<p>Bowtie 2 uses the <a href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> to find ungapped alignments for seeds. This step accounts for the bulk of Bowtie 2's memory footprint, as the <a href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> itself is typically the largest data structure used. For instance, the memory footprint of the <a href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> for the human genome is about 3.2 gigabytes of RAM.</p> +<p>Bowtie 2 uses the <a +href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> to find +ungapped alignments for seeds. This step accounts for the bulk of Bowtie +2's memory footprint, as the <a +href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> itself +is typically the largest data structure used. For instance, the memory +footprint of the <a +href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> for the +human genome is about 3.2 gigabytes of RAM.</p> <h2 id="ambiguous-characters">Ambiguous characters</h2> -<p>Non-whitespace characters besides A, C, G or T are considered "ambiguous." N is a common ambiguous character that appears in reference sequences. Bowtie 2 considers all ambiguous characters in the reference (including <a href="http://www.bioinformatics.org/sms/iupac.html">IUPAC nucleotide codes</a>) to be Ns.</p> -<p>Bowtie 2 allows alignments to overlap ambiguous characters in the reference. An alignment position that contains an ambiguous character in the read, reference, or both, is penalized according to <a href="#bowtie2-options-np"><code>--np</code></a>. <a href="#bowtie2-options-n-ceil"><code>--n-ceil</code></a> sets an upper limit on the number of positions that may contain ambiguous reference characters in a valid alignment. The optional field <a href="#bowtie2-build-opt-fields-xn"><code>XN:i</code></a> reports the number of ambiguous reference characters overlapped by an alignment.</p> -<p>Note that the <a href="#multiseed-heuristic">multiseed heuristic</a> cannot find <em>seed</em> alignments that overlap ambiguous reference characters. For an alignment overlapping an ambiguous reference character to be found, it must have one or more seed alignments that do not overlap ambiguous reference characters.</p> -<h2 id="presets-setting-many-settings-at-once">Presets: setting many settings at once</h2> -<p>Bowtie 2 comes with some useful combinations of parameters packaged into shorter "preset" parameters. For example, running Bowtie 2 with the <a href="#bowtie2-options-very-sensitive"><code>--very-sensitive</code></a> option is the same as running with options: <code>-D 20 -R 3 -N 0 -L 20 -i S,1,0.50</code>. The preset options that come with Bowtie 2 are designed to cover a wide area of the speed/sensitivity/accuracy trade-off space, with the presets ending in <code>fast</code> generally being faster but less sensitive and less accurate, and the presets ending in <code>sensitive</code> generally being slower but more sensitive and more accurate. See the <a href="#preset-options-in---end-to-end-mode">documentation for the preset options</a> for details.</p> -<p>As of Bowtie2 v2.4.0, individual preset values can be overridden by providing the specific options e.g. the configured seed length of 20 in the [<code>--very-senitive</code>] preset above can be changed to 25 by also specifying the <code>-L 25</code> parameter anywhere on the command line.</p> +<p>Non-whitespace characters besides A, C, G or T are considered +"ambiguous." N is a common ambiguous character that appears in reference +sequences. Bowtie 2 considers all ambiguous characters in the reference +(including <a href="http://www.bioinformatics.org/sms/iupac.html">IUPAC +nucleotide codes</a>) to be Ns.</p> +<p>Bowtie 2 allows alignments to overlap ambiguous characters in the +reference. An alignment position that contains an ambiguous character in +the read, reference, or both, is penalized according to <a +href="#bowtie2-options-np"><code>--np</code></a>. <a +href="#bowtie2-options-n-ceil"><code>--n-ceil</code></a> sets an upper +limit on the number of positions that may contain ambiguous reference +characters in a valid alignment. The optional field <a +href="#bowtie2-build-opt-fields-xn"><code>XN:i</code></a> reports the +number of ambiguous reference characters overlapped by an alignment.</p> +<p>Note that the <a href="#multiseed-heuristic">multiseed heuristic</a> +cannot find <em>seed</em> alignments that overlap ambiguous reference +characters. For an alignment overlapping an ambiguous reference +character to be found, it must have one or more seed alignments that do +not overlap ambiguous reference characters.</p> +<h2 id="presets-setting-many-settings-at-once">Presets: setting many +settings at once</h2> +<p>Bowtie 2 comes with some useful combinations of parameters packaged +into shorter "preset" parameters. For example, running Bowtie 2 with the +<a +href="#bowtie2-options-very-sensitive"><code>--very-sensitive</code></a> +option is the same as running with options: +<code>-D 20 -R 3 -N 0 -L 20 -i S,1,0.50</code>. The preset options that +come with Bowtie 2 are designed to cover a wide area of the +speed/sensitivity/accuracy trade-off space, with the presets ending in +<code>fast</code> generally being faster but less sensitive and less +accurate, and the presets ending in <code>sensitive</code> generally +being slower but more sensitive and more accurate. See the <a +href="#preset-options-in---end-to-end-mode">documentation for the preset +options</a> for details.</p> +<p>As of Bowtie2 v2.4.0, individual preset values can be overridden by +providing the specific options e.g. the configured seed length of 20 in +the [<code>--very-senitive</code>] preset above can be changed to 25 by +also specifying the <code>-L 25</code> parameter anywhere on the command +line.</p> <h2 id="filtering">Filtering</h2> -<p>Some reads are skipped or "filtered out" by Bowtie 2. For example, reads may be filtered out because they are extremely short or have a high proportion of ambiguous nucleotides. Bowtie 2 will still print a SAM record for such a read, but no alignment will be reported and the <code>YF:i</code> SAM optional field will be set to indicate the reason the read was filtered.</p> +<p>Some reads are skipped or "filtered out" by Bowtie 2. For example, +reads may be filtered out because they are extremely short or have a +high proportion of ambiguous nucleotides. Bowtie 2 will still print a +SAM record for such a read, but no alignment will be reported and the +<code>YF:i</code> SAM optional field will be set to indicate the reason +the read was filtered.</p> <ul> -<li><code>YF:Z:LN</code>: the read was filtered because it had length less than or equal to the number of seed mismatches set with the <a href="#bowtie2-options-N"><code>-N</code></a> option.</li> -<li><code>YF:Z:NS</code>: the read was filtered because it contains a number of ambiguous characters (usually <code>N</code> or <code>.</code>) greater than the ceiling specified with <a href="#bowtie2-options-n-ceil"><code>--n-ceil</code></a>.</li> -<li><code>YF:Z:SC</code>: the read was filtered because the read length and the match bonus (set with <a href="#bowtie2-options-ma"><code>--ma</code></a>) are such that the read can't possibly earn an alignment score greater than or equal to the threshold set with <a href="#bowtie2-options-score-min"><code>--score-min</code></a></li> -<li><code>YF:Z:QC</code>: the read was filtered because it was marked as failing quality control and the user specified the <a href="#bowtie2-options-qc-filter"><code>--qc-filter</code></a> option. This only happens when the input is in Illumina's QSEQ format (i.e. when <a href="#bowtie2-options-qseq"><code>--qseq</code></a> is specified) and the last (11th) field of the read's QSEQ record contains <code>1</code>.</li> +<li><code>YF:Z:LN</code>: the read was filtered because it had length +less than or equal to the number of seed mismatches set with the <a +href="#bowtie2-options-N"><code>-N</code></a> option.</li> +<li><code>YF:Z:NS</code>: the read was filtered because it contains a +number of ambiguous characters (usually <code>N</code> or +<code>.</code>) greater than the ceiling specified with <a +href="#bowtie2-options-n-ceil"><code>--n-ceil</code></a>.</li> +<li><code>YF:Z:SC</code>: the read was filtered because the read length +and the match bonus (set with <a +href="#bowtie2-options-ma"><code>--ma</code></a>) are such that the read +can't possibly earn an alignment score greater than or equal to the +threshold set with <a +href="#bowtie2-options-score-min"><code>--score-min</code></a></li> +<li><code>YF:Z:QC</code>: the read was filtered because it was marked as +failing quality control and the user specified the <a +href="#bowtie2-options-qc-filter"><code>--qc-filter</code></a> option. +This only happens when the input is in Illumina's QSEQ format (i.e. when +<a href="#bowtie2-options-qseq"><code>--qseq</code></a> is specified) +and the last (11th) field of the read's QSEQ record contains +<code>1</code>.</li> </ul> -<p>If a read could be filtered for more than one reason, the value <code>YF:Z</code> flag will reflect only one of those reasons.</p> +<p>If a read could be filtered for more than one reason, the value +<code>YF:Z</code> flag will reflect only one of those reasons.</p> <h2 id="alignment-summary">Alignment summary</h2> -<p>When Bowtie 2 finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle. For datasets consisting of unpaired reads, the summary might look like this:</p> +<p>When Bowtie 2 finishes running, it prints messages summarizing what +happened. These messages are printed to the "standard error" ("stderr") +filehandle. For datasets consisting of unpaired reads, the summary might +look like this:</p> <pre><code>20000 reads; of these: 20000 (100.00%) were unpaired; of these: 1247 (6.24%) aligned 0 times 18739 (93.69%) aligned exactly 1 time 14 (0.07%) aligned >1 times 93.77% overall alignment rate</code></pre> -<p>For datasets consisting of pairs, the summary might look like this:</p> +<p>For datasets consisting of pairs, the summary might look like +this:</p> <pre><code>10000 reads; of these: 10000 (100.00%) were paired; of these: 650 (6.50%) aligned concordantly 0 times @@ -312,27 +901,82 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr 96.70% overall alignment rate</code></pre> <p>The indentation indicates how subtotals relate to totals.</p> <h2 id="wrapper-scripts">Wrapper scripts</h2> -<p>The <code>bowtie2</code>, <code>bowtie2-build</code> and <code>bowtie2-inspect</code> executables are actually wrapper scripts that call binary programs as appropriate. The wrappers shield users from having to distinguish between "small" and "large" index formats, discussed briefly in the following section. Also, the <code>bowtie2</code> wrapper provides some key functionality, like the ability to handle compressed inputs, and the functionality for <a href="#bowtie2-options-un"><code>--un</code></a>, <a href="#bowtie2-options-al"><code>--al</code></a> and related options.</p> -<p>It is recommended that you always run the bowtie2 wrappers and not run the binaries directly.</p> +<p>The <code>bowtie2</code>, <code>bowtie2-build</code> and +<code>bowtie2-inspect</code> executables are actually wrapper scripts +that call binary programs as appropriate. The wrappers shield users from +having to distinguish between "small" and "large" index formats, +discussed briefly in the following section. Also, the +<code>bowtie2</code> wrapper provides some key functionality, like the +ability to handle compressed inputs, and the functionality for <a +href="#bowtie2-options-un"><code>--un</code></a>, <a +href="#bowtie2-options-al"><code>--al</code></a> and related +options.</p> +<p>It is recommended that you always run the bowtie2 wrappers and not +run the binaries directly.</p> <h2 id="small-and-large-indexes">Small and large indexes</h2> -<p><code>bowtie2-build</code> can index reference genomes of any size. For genomes less than about 4 billion nucleotides in length, <code>bowtie2-build</code> builds a "small" index using 32-bit numbers in various parts of the index. When the genome is longer, <code>bowtie2-build</code> builds a "large" index using 64-bit numbers. Small indexes are stored in files with the <code>.bt2</code> extension, and large indexes are stored in files with the <code>.bt2l</code> extension. The user need not worry about whether a particular index is small or large; the wrapper scripts will automatically build and use the appropriate index.</p> +<p><code>bowtie2-build</code> can index reference genomes of any size. +For genomes less than about 4 billion nucleotides in length, +<code>bowtie2-build</code> builds a "small" index using 32-bit numbers +in various parts of the index. When the genome is longer, +<code>bowtie2-build</code> builds a "large" index using 64-bit numbers. +Small indexes are stored in files with the <code>.bt2</code> extension, +and large indexes are stored in files with the <code>.bt2l</code> +extension. The user need not worry about whether a particular index is +small or large; the wrapper scripts will automatically build and use the +appropriate index.</p> <h2 id="performance-tuning">Performance tuning</h2> <ol type="1"> -<li><p>If your computer has multiple processors/cores, use <code>-p</code></p> -<p>The <a href="#bowtie2-options-p"><code>-p</code></a> option causes Bowtie 2 to launch a specified number of parallel search threads. Each thread runs on a different processor/core and all threads find alignments in parallel, increasing alignment throughput by approximately a multiple of the number of threads (though in practice, speedup is somewhat worse than linear).</p></li> -<li><p>If reporting many alignments per read, try reducing <code>bowtie2-build --offrate</code></p> -<p>If you are using <a href="#bowtie2-options-k"><code>-k</code></a> or <a href="#bowtie2-options-a"><code>-a</code></a> options and Bowtie 2 is reporting many alignments per read, using an index with a denser SA sample can speed things up considerably. To do this, specify a smaller-than-default <a href="#bowtie2-options-o"><code>-o</code>/<code>--offrate</code></a> value when running <code>bowtie2-build</code>. A denser SA sample yields a larger index, but is also particularly effective at speeding up alignment when many alignments are reported per read.</p></li> -<li><p>If <code>bowtie2</code> "thrashes", try increasing <code>bowtie2-build --offrate</code></p> -<p>If <code>bowtie2</code> runs very slowly on a relatively low-memory computer, try setting <a href="#bowtie2-options-o"><code>-o</code>/<code>--offrate</code></a> to a <em>larger</em> value when building the index. This decreases the memory footprint of the index.</p></li> +<li><p>If your computer has multiple processors/cores, use +<code>-p</code></p> +<p>The <a href="#bowtie2-options-p"><code>-p</code></a> option causes +Bowtie 2 to launch a specified number of parallel search threads. Each +thread runs on a different processor/core and all threads find +alignments in parallel, increasing alignment throughput by approximately +a multiple of the number of threads (though in practice, speedup is +somewhat worse than linear).</p></li> +<li><p>If reporting many alignments per read, try reducing +<code>bowtie2-build --offrate</code></p> +<p>If you are using <a href="#bowtie2-options-k"><code>-k</code></a> or +<a href="#bowtie2-options-a"><code>-a</code></a> options and Bowtie 2 is +reporting many alignments per read, using an index with a denser SA +sample can speed things up considerably. To do this, specify a +smaller-than-default <a +href="#bowtie2-options-o"><code>-o</code>/<code>--offrate</code></a> +value when running <code>bowtie2-build</code>. A denser SA sample yields +a larger index, but is also particularly effective at speeding up +alignment when many alignments are reported per read.</p></li> +<li><p>If <code>bowtie2</code> "thrashes", try increasing +<code>bowtie2-build --offrate</code></p> +<p>If <code>bowtie2</code> runs very slowly on a relatively low-memory +computer, try setting <a +href="#bowtie2-options-o"><code>-o</code>/<code>--offrate</code></a> to +a <em>larger</em> value when building the index. This decreases the +memory footprint of the index.</p></li> </ol> <h2 id="command-line">Command Line</h2> <h3 id="setting-function-options">Setting function options</h3> -<p>Some Bowtie 2 options specify a function rather than an individual number or setting. In these cases the user specifies three parameters: (a) a function type <code>F</code>, (b) a constant term <code>B</code>, and (c) a coefficient <code>A</code>. The available function types are constant (<code>C</code>), linear (<code>L</code>), square-root (<code>S</code>), and natural log (<code>G</code>). The parameters are specified as <code>F,B,A</code> - that is, the function type, the constant term, and the coefficient are separated by commas with no whitespace. The constant term and coefficient may be negative and/or floating-point numbers.</p> -<p>For example, if the function specification is <code>L,-0.4,-0.6</code>, then the function defined is:</p> +<p>Some Bowtie 2 options specify a function rather than an individual +number or setting. In these cases the user specifies three parameters: +(a) a function type <code>F</code>, (b) a constant term <code>B</code>, +and (c) a coefficient <code>A</code>. The available function types are +constant (<code>C</code>), linear (<code>L</code>), square-root +(<code>S</code>), and natural log (<code>G</code>). The parameters are +specified as <code>F,B,A</code> - that is, the function type, the +constant term, and the coefficient are separated by commas with no +whitespace. The constant term and coefficient may be negative and/or +floating-point numbers.</p> +<p>For example, if the function specification is +<code>L,-0.4,-0.6</code>, then the function defined is:</p> <pre><code>f(x) = -0.4 + -0.6 * x</code></pre> -<p>If the function specification is <code>G,1,5.4</code>, then the function defined is:</p> +<p>If the function specification is <code>G,1,5.4</code>, then the +function defined is:</p> <pre><code>f(x) = 1.0 + 5.4 * ln(x)</code></pre> -<p>See the documentation for the option in question to learn what the parameter <code>x</code> is for. For example, in the case if the <a href="#bowtie2-options-score-min"><code>--score-min</code></a> option, the function <code>f(x)</code> sets the minimum alignment score necessary for an alignment to be considered valid, and <code>x</code> is the read length.</p> +<p>See the documentation for the option in question to learn what the +parameter <code>x</code> is for. For example, in the case if the <a +href="#bowtie2-options-score-min"><code>--score-min</code></a> option, +the function <code>f(x)</code> sets the minimum alignment score +necessary for an alignment to be considered valid, and <code>x</code> is +the read length.</p> <h3 id="usage">Usage</h3> <pre><code>bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i> | --sra-acc <acc> | b <bam>} -S [<sam>]</code></pre> <h3 id="main-arguments">Main arguments</h3> @@ -342,7 +986,12 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-x <bt2-idx></code></pre> </td> <td> -<p>The basename of the index for the reference genome. The basename is the name of any of the index files up to but not including the final <code>.1.bt2</code> / <code>.rev.1.bt2</code> / etc. <code>bowtie2</code> looks for the specified index first in the current directory, then in the directory specified in the <code>BOWTIE2_INDEXES</code> environment variable.</p> +<p>The basename of the index for the reference genome. The basename is +the name of any of the index files up to but not including the final +<code>.1.bt2</code> / <code>.rev.1.bt2</code> / etc. +<code>bowtie2</code> looks for the specified index first in the current +directory, then in the directory specified in the +<code>BOWTIE2_INDEXES</code> environment variable.</p> </td> </tr> <tr> @@ -350,7 +999,13 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-1 <m1></code></pre> </td> <td> -<p>Comma-separated list of files containing mate 1s (filename usually includes <code>_1</code>), e.g. <code>-1 flyA_1.fq,flyB_1.fq</code>. Sequences specified with this option must correspond file-for-file and read-for-read with those specified in <code><m2></code>. Reads may be a mix of different lengths. If <code>-</code> is specified, <code>bowtie2</code> will read the mate 1s from the "standard in" or "stdin" filehandle.</p> +<p>Comma-separated list of files containing mate 1s (filename usually +includes <code>_1</code>), e.g. <code>-1 flyA_1.fq,flyB_1.fq</code>. +Sequences specified with this option must correspond file-for-file and +read-for-read with those specified in <code><m2></code>. Reads may +be a mix of different lengths. If <code>-</code> is specified, +<code>bowtie2</code> will read the mate 1s from the "standard in" or +"stdin" filehandle.</p> </td> </tr> <tr> @@ -358,7 +1013,13 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-2 <m2></code></pre> </td> <td> -<p>Comma-separated list of files containing mate 2s (filename usually includes <code>_2</code>), e.g. <code>-2 flyA_2.fq,flyB_2.fq</code>. Sequences specified with this option must correspond file-for-file and read-for-read with those specified in <code><m1></code>. Reads may be a mix of different lengths. If <code>-</code> is specified, <code>bowtie2</code> will read the mate 2s from the "standard in" or "stdin" filehandle.</p> +<p>Comma-separated list of files containing mate 2s (filename usually +includes <code>_2</code>), e.g. <code>-2 flyA_2.fq,flyB_2.fq</code>. +Sequences specified with this option must correspond file-for-file and +read-for-read with those specified in <code><m1></code>. Reads may +be a mix of different lengths. If <code>-</code> is specified, +<code>bowtie2</code> will read the mate 2s from the "standard in" or +"stdin" filehandle.</p> </td> </tr> <tr> @@ -366,7 +1027,11 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-U <r></code></pre> </td> <td> -<p>Comma-separated list of files containing unpaired reads to be aligned, e.g. <code>lane1.fq,lane2.fq,lane3.fq,lane4.fq</code>. Reads may be a mix of different lengths. If <code>-</code> is specified, <code>bowtie2</code> gets the reads from the "standard in" or "stdin" filehandle.</p> +<p>Comma-separated list of files containing unpaired reads to be +aligned, e.g. <code>lane1.fq,lane2.fq,lane3.fq,lane4.fq</code>. Reads +may be a mix of different lengths. If <code>-</code> is specified, +<code>bowtie2</code> gets the reads from the "standard in" or "stdin" +filehandle.</p> </td> </tr> <tr> @@ -374,7 +1039,8 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>--interleaved</code></pre> </td> <td> -<p>Reads interleaved FASTQ files where the first two records (8 lines) represent a mate pair.</p> +<p>Reads interleaved FASTQ files where the first two records (8 lines) +represent a mate pair.</p> </td> </tr> <tr> @@ -382,8 +1048,14 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>--sra-acc</code></pre> </td> <td> -<p>Reads are SRA accessions. If the accession provided cannot be found in local storage it will be fetched from the NCBI database. If you find that SRA alignments are long running please rerun your command with the <a href="#bowtie2-options-p"><code>-p</code>/<code>--threads</code></a> parameter set to desired number of threads.</p> -<p>NB: this option is only available if bowtie 2 is compiled with the necessary SRA libraries. See <a href="#obtaining-bowtie-2">Obtaining Bowtie 2</a> for details.</p> +<p>Reads are SRA accessions. If the accession provided cannot be found +in local storage it will be fetched from the NCBI database. If you find +that SRA alignments are long running please rerun your command with the +<a href="#bowtie2-options-p"><code>-p</code>/<code>--threads</code></a> +parameter set to desired number of threads.</p> +<p>NB: this option is only available if bowtie 2 is compiled with the +necessary SRA libraries. See <a href="#obtaining-bowtie-2">Obtaining +Bowtie 2</a> for details.</p> </td> </tr> <tr> @@ -391,7 +1063,11 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-b <bam></code></pre> </td> <td> -<p>Reads are unaligned BAM records sorted by read name. The <a href="#bowtie2-options-align-paired-reads"><code>--align-paired-reads</code></a> and <a href="#bowtie2-options-preserve-tags"><code>--preserve-tags</code></a> options affect the way Bowtie 2 processes records.</p> +<p>Reads are unaligned BAM records sorted by read name. The <a +href="#bowtie2-options-align-paired-reads"><code>--align-paired-reads</code></a> +and <a +href="#bowtie2-options-preserve-tags"><code>--preserve-tags</code></a> +options affect the way Bowtie 2 processes records.</p> </td> </tr> <tr> @@ -399,7 +1075,8 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-S <sam></code></pre> </td> <td> -<p>File to write SAM alignments to. By default, alignments are written to the "standard out" or "stdout" filehandle (i.e. the console).</p> +<p>File to write SAM alignments to. By default, alignments are written +to the "standard out" or "stdout" filehandle (i.e. the console).</p> </td> </tr> </table> @@ -411,7 +1088,12 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-q</code></pre> </td> <td> -<p>Reads (specified with <code><m1></code>, <code><m2></code>, <code><s></code>) are FASTQ files. FASTQ files usually have extension <code>.fq</code> or <code>.fastq</code>. FASTQ is the default format. See also: <a href="#bowtie2-options-solexa-quals"><code>--solexa-quals</code></a> and <a href="#bowtie2-options-int-quals"><code>--int-quals</code></a>.</p> +<p>Reads (specified with <code><m1></code>, +<code><m2></code>, <code><s></code>) are FASTQ files. FASTQ +files usually have extension <code>.fq</code> or <code>.fastq</code>. +FASTQ is the default format. See also: <a +href="#bowtie2-options-solexa-quals"><code>--solexa-quals</code></a> and +<a href="#bowtie2-options-int-quals"><code>--int-quals</code></a>.</p> </td> </tr> <tr> @@ -419,7 +1101,11 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>--tab5</code></pre> </td> <td> -<p>Each read or pair is on a single line. An unpaired read line is <code>[name]\t[seq]\t[qual]\n</code>. A paired-end read line is <code>[name]\t[seq1]\t[qual1]\t[seq2]\t[qual2]\n</code>. An input file can be a mix of unpaired and paired-end reads and Bowtie 2 recognizes each according to the number of fields, handling each as it should.</p> +<p>Each read or pair is on a single line. An unpaired read line is +<code>[name]\t[seq]\t[qual]\n</code>. A paired-end read line is +<code>[name]\t[seq1]\t[qual1]\t[seq2]\t[qual2]\n</code>. An input file +can be a mix of unpaired and paired-end reads and Bowtie 2 recognizes +each according to the number of fields, handling each as it should.</p> </td> </tr> <tr> @@ -427,7 +1113,10 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>--tab6</code></pre> </td> <td> -<p>Similar to <a href="#bowtie2-options-tab5"><code>--tab5</code></a> except, for paired-end reads, the second end can have a different name from the first: <code>[name1]\t[seq1]\t[qual1]\t[name2]\t[seq2]\t[qual2]\n</code></p> +<p>Similar to <a href="#bowtie2-options-tab5"><code>--tab5</code></a> +except, for paired-end reads, the second end can have a different name +from the first: +<code>[name1]\t[seq1]\t[qual1]\t[name2]\t[seq2]\t[qual2]\n</code></p> </td> </tr> <tr> @@ -435,7 +1124,11 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>--qseq</code></pre> </td> <td> -<p>Reads (specified with <code><m1></code>, <code><m2></code>, <code><s></code>) are QSEQ files. QSEQ files usually end in <code>_qseq.txt</code>. See also: <a href="#bowtie2-options-solexa-quals"><code>--solexa-quals</code></a> and <a href="#bowtie2-options-int-quals"><code>--int-quals</code></a>.</p> +<p>Reads (specified with <code><m1></code>, +<code><m2></code>, <code><s></code>) are QSEQ files. QSEQ +files usually end in <code>_qseq.txt</code>. See also: <a +href="#bowtie2-options-solexa-quals"><code>--solexa-quals</code></a> and +<a href="#bowtie2-options-int-quals"><code>--int-quals</code></a>.</p> </td> </tr> <tr> @@ -443,7 +1136,17 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-f</code></pre> </td> <td> -<p>Reads (specified with <code><m1></code>, <code><m2></code>, <code><s></code>) are <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files. <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files usually have extension <code>.fa</code>, <code>.fasta</code>, <code>.mfa</code>, <code>.fna</code> or similar. <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files do not have a way of specifying quality values, so when <code>-f</code> is set, the result is as if <a href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a> is also set.</p> +<p>Reads (specified with <code><m1></code>, +<code><m2></code>, <code><s></code>) are <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files. +<a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> +files usually have extension <code>.fa</code>, <code>.fasta</code>, +<code>.mfa</code>, <code>.fna</code> or similar. <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files +do not have a way of specifying quality values, so when <code>-f</code> +is set, the result is as if <a +href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a> is +also set.</p> </td> </tr> <tr> @@ -451,7 +1154,12 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-r</code></pre> </td> <td> -<p>Reads (specified with <code><m1></code>, <code><m2></code>, <code><s></code>) are files with one input sequence per line, without any other information (no read names, no qualities). When <code>-r</code> is set, the result is as if <a href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a> is also set.</p> +<p>Reads (specified with <code><m1></code>, +<code><m2></code>, <code><s></code>) are files with one +input sequence per line, without any other information (no read names, +no qualities). When <code>-r</code> is set, the result is as if <a +href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a> is +also set.</p> </td> </tr> <tr> @@ -459,7 +1167,17 @@ Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC</code></pr <pre><code>-F k:<int>,i:<int></code></pre> </td> <td> -Reads are substrings (k-mers) extracted from a FASTA file <code><s></code>. Specifically, for every reference sequence in FASTA file <code><s></code>, Bowtie 2 aligns the k-mers at offsets 1, 1+i, 1+2i, ... until reaching the end of the reference. Each k-mer is aligned as a separate read. Quality values are set to all Is (40 on Phred scale). Each k-mer (read) is given a name like <code><sequence>_<offset></code>, where <code><sequence></code> is the name of the FASTA sequence it was drawn from and <code><offset></code> is its 0-based offset of origin with respect to the sequence. Only single k-mers, i.e. unpaired reads, can be aligned in this way. +Reads are substrings (k-mers) extracted from a FASTA file +<code><s></code>. Specifically, for every reference sequence in +FASTA file <code><s></code>, Bowtie 2 aligns the k-mers at offsets +1, 1+i, 1+2i, ... until reaching the end of the reference. Each k-mer is +aligned as a separate read. Quality values are set to all Is (40 on +Phred scale). Each k-mer (read) is given a name like +<code><sequence>_<offset></code>, where +<code><sequence></code> is the name of the FASTA sequence it was +drawn from and <code><offset></code> is its 0-based offset of +origin with respect to the sequence. Only single k-mers, i.e. unpaired +reads, can be aligned in this way. </td> </tr> <tr> @@ -467,7 +1185,12 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-c</code></pre> </td> <td> -<p>The read sequences are given on command line. I.e. <code><m1></code>, <code><m2></code> and <code><singles></code> are comma-separated lists of reads rather than lists of read files. There is no way to specify read names or qualities, so <code>-c</code> also implies <a href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a>.</p> +<p>The read sequences are given on command line. I.e. +<code><m1></code>, <code><m2></code> and +<code><singles></code> are comma-separated lists of reads rather +than lists of read files. There is no way to specify read names or +qualities, so <code>-c</code> also implies <a +href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a>.</p> </td> </tr> <tr> @@ -475,7 +1198,8 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-s/--skip <int></code></pre> </td> <td> -<p>Skip (i.e. do not align) the first <code><int></code> reads or pairs in the input.</p> +<p>Skip (i.e. do not align) the first <code><int></code> reads or +pairs in the input.</p> </td> </tr> <tr> @@ -483,7 +1207,10 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-u/--qupto <int></code></pre> </td> <td> -<p>Align the first <code><int></code> reads or read pairs from the input (after the <a href="#bowtie2-options-s"><code>-s</code>/<code>--skip</code></a> reads or pairs have been skipped), then stop. Default: no limit.</p> +<p>Align the first <code><int></code> reads or read pairs from the +input (after the <a +href="#bowtie2-options-s"><code>-s</code>/<code>--skip</code></a> reads +or pairs have been skipped), then stop. Default: no limit.</p> </td> </tr> <tr> @@ -491,7 +1218,8 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-5/--trim5 <int></code></pre> </td> <td> -<p>Trim <code><int></code> bases from 5' (left) end of each read before alignment (default: 0).</p> +<p>Trim <code><int></code> bases from 5' (left) end of each read +before alignment (default: 0).</p> </td> </tr> <tr> @@ -499,7 +1227,8 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-3/--trim3 <int></code></pre> </td> <td> -<p>Trim <code><int></code> bases from 3' (right) end of each read before alignment (default: 0).</p> +<p>Trim <code><int></code> bases from 3' (right) end of each read +before alignment (default: 0).</p> </td> </tr> <tr> @@ -507,7 +1236,14 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>--trim-to [3:|5:]<int></code></pre> </td> <td> -<p>Trim reads exceeding <code><int></code> bases. Bases will be trimmed from either the 3' (right) or 5' (left) end of the read. If the read end if not specified, bowtie 2 will default to trimming from the 3' (right) end of the read. <a href="#bowtie2-options-trim-to"><code>--trim-to</code></a> and <a href="#bowtie2-options-3"><code>-3</code></a>/<a href="#bowtie2-options-5"><code>-5</code></a> are mutually exclusive.</p> +<p>Trim reads exceeding <code><int></code> bases. Bases will be +trimmed from either the 3' (right) or 5' (left) end of the read. If the +read end if not specified, bowtie 2 will default to trimming from the 3' +(right) end of the read. <a +href="#bowtie2-options-trim-to"><code>--trim-to</code></a> and <a +href="#bowtie2-options-3"><code>-3</code></a>/<a +href="#bowtie2-options-5"><code>-5</code></a> are mutually +exclusive.</p> </td> </tr> <tr> @@ -515,7 +1251,10 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>--phred33</code></pre> </td> <td> -<p>Input qualities are ASCII chars equal to the <a href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred quality</a> plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines.</p> +<p>Input qualities are ASCII chars equal to the <a +href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred +quality</a> plus 33. This is also called the "Phred+33" encoding, which +is used by the very latest Illumina pipelines.</p> </td> </tr> <tr> @@ -523,7 +1262,9 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>--phred64</code></pre> </td> <td> -<p>Input qualities are ASCII chars equal to the <a href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred quality</a> plus 64. This is also called the "Phred+64" encoding.</p> +<p>Input qualities are ASCII chars equal to the <a +href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred +quality</a> plus 64. This is also called the "Phred+64" encoding.</p> </td> </tr> <tr> @@ -531,7 +1272,12 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>--solexa-quals</code></pre> </td> <td> -<p>Convert input qualities from <a href="http://en.wikipedia.org/wiki/Phred_quality_score">Solexa</a> (which can be negative) to <a href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred</a> (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3). Default: off.</p> +<p>Convert input qualities from <a +href="http://en.wikipedia.org/wiki/Phred_quality_score">Solexa</a> +(which can be negative) to <a +href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred</a> (which +can't). This scheme was used in older Illumina GA Pipeline versions +(prior to 1.3). Default: off.</p> </td> </tr> <tr> @@ -539,11 +1285,19 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>--int-quals</code></pre> </td> <td> -<p>Quality values are represented in the read input file as space-separated ASCII integers, e.g., <code>40 40 30 40</code>..., rather than ASCII characters, e.g., <code>II?I</code>.... Integers are treated as being on the <a href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred quality</a> scale unless <a href="#bowtie2-options-solexa-quals"><code>--solexa-quals</code></a> is also specified. Default: off.</p> +<p>Quality values are represented in the read input file as +space-separated ASCII integers, e.g., <code>40 40 30 40</code>..., +rather than ASCII characters, e.g., <code>II?I</code>.... Integers are +treated as being on the <a +href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred +quality</a> scale unless <a +href="#bowtie2-options-solexa-quals"><code>--solexa-quals</code></a> is +also specified. Default: off.</p> </td> </tr> </table> -<h4 id="preset-options-in---end-to-end-mode">Preset options in <code>--end-to-end</code> mode</h4> +<h4 id="preset-options-in---end-to-end-mode">Preset options in +<code>--end-to-end</code> mode</h4> <table> <tr> <td id="bowtie2-options-very-fast"> @@ -566,7 +1320,9 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>--sensitive</code></pre> </td> <td> -<p>Same as: <code>-D 15 -R 2 -N 0 -L 22 -i S,1,1.15</code> (default in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode)</p> +<p>Same as: <code>-D 15 -R 2 -N 0 -L 22 -i S,1,1.15</code> (default in +<a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> +mode)</p> </td> </tr> <tr> @@ -578,7 +1334,8 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> </td> </tr> </table> -<h4 id="preset-options-in---local-mode">Preset options in <code>--local</code> mode</h4> +<h4 id="preset-options-in---local-mode">Preset options in +<code>--local</code> mode</h4> <table> <tr> <td id="bowtie2-options-very-fast-local"> @@ -601,7 +1358,8 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>--sensitive-local</code></pre> </td> <td> -<p>Same as: <code>-D 15 -R 2 -N 0 -L 20 -i S,1,0.75</code> (default in <a href="#bowtie2-options-local"><code>--local</code></a> mode)</p> +<p>Same as: <code>-D 15 -R 2 -N 0 -L 20 -i S,1,0.75</code> (default in +<a href="#bowtie2-options-local"><code>--local</code></a> mode)</p> </td> </tr> <tr> @@ -620,7 +1378,10 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-N <int></code></pre> </td> <td> -<p>Sets the number of mismatches to allowed in a seed alignment during <a href="#multiseed-heuristic">multiseed alignment</a>. Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity. Default: 0.</p> +<p>Sets the number of mismatches to allowed in a seed alignment during +<a href="#multiseed-heuristic">multiseed alignment</a>. Can be set to 0 +or 1. Setting this higher makes alignment slower (often much slower) but +increases sensitivity. Default: 0.</p> </td> </tr> <tr> @@ -628,7 +1389,14 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-L <int></code></pre> </td> <td> -<p>Sets the length of the seed substrings to align during <a href="#multiseed-heuristic">multiseed alignment</a>. Smaller values make alignment slower but more sensitive. Default: the <a href="#bowtie2-options-sensitive"><code>--sensitive</code></a> preset is used by default, which sets <code>-L</code> to 22 and 20 in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode and in <a href="#bowtie2-options-local"><code>--local</code></a> mode.</p> +<p>Sets the length of the seed substrings to align during <a +href="#multiseed-heuristic">multiseed alignment</a>. Smaller values make +alignment slower but more sensitive. Default: the <a +href="#bowtie2-options-sensitive"><code>--sensitive</code></a> preset is +used by default, which sets <code>-L</code> to 22 and 20 in <a +href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode +and in <a href="#bowtie2-options-local"><code>--local</code></a> +mode.</p> </td> </tr> <tr> @@ -636,7 +1404,10 @@ Reads are substrings (k-mers) extracted from a FASTA file <code><s></code> <pre><code>-i <func></code></pre> </td> <td> -<p>Sets a function governing the interval between seed substrings to use during <a href="#multiseed-heuristic">multiseed alignment</a>. For instance, if the read has 30 characters, and seed length is 10, and the seed interval is 6, the seeds extracted will be:</p> +<p>Sets a function governing the interval between seed substrings to use +during <a href="#multiseed-heuristic">multiseed alignment</a>. For +instance, if the read has 30 characters, and seed length is 10, and the +seed interval is 6, the seeds extracted will be:</p> <pre><code>Read: TAGCTACGCTCTACGCTATCATGCATAAAC Seed 1 fw: TAGCTACGCT Seed 1 rc: AGCGTAGCTA @@ -646,7 +1417,19 @@ Seed 3 fw: ACGCTATCAT Seed 3 rc: ATGATAGCGT Seed 4 fw: TCATGCATAA Seed 4 rc: TTATGCATGA</code></pre> -<p>Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying <code>-i S,1,2.5</code> sets the interval function <code>f</code> to <code>f(x) = 1 + 2.5 * sqrt(x)</code>, where x is the read length. See also: <a href="#setting-function-options">setting function options</a>. If the function returns a result less than 1, it is rounded up to 1. Default: the <a href="#bowtie2-options-sensitive"><code>--sensitive</code></a> preset is used by default, which sets <code>-i</code> to <code>S,1,1.15</code> in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode to <code>-i S,1,0.75</code> in <a href="#bowtie2-options-local"><code>--local</code></a> mode.</p> +<p>Since it's best to use longer intervals for longer reads, this +parameter sets the interval as a function of the read length, rather +than a single one-size-fits-all number. For instance, specifying +<code>-i S,1,2.5</code> sets the interval function <code>f</code> to +<code>f(x) = 1 + 2.5 * sqrt(x)</code>, where x is the read length. See +also: <a href="#setting-function-options">setting function options</a>. +If the function returns a result less than 1, it is rounded up to 1. +Default: the <a +href="#bowtie2-options-sensitive"><code>--sensitive</code></a> preset is +used by default, which sets <code>-i</code> to <code>S,1,1.15</code> in +<a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode +to <code>-i S,1,0.75</code> in <a +href="#bowtie2-options-local"><code>--local</code></a> mode.</p> </td> </tr> <tr> @@ -654,7 +1437,14 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--n-ceil <func></code></pre> </td> <td> -<p>Sets a function governing the maximum number of ambiguous characters (usually <code>N</code>s and/or <code>.</code>s) allowed in a read as a function of read length. For instance, specifying <code>-L,0,0.15</code> sets the N-ceiling function <code>f</code> to <code>f(x) = 0 + 0.15 * x</code>, where x is the read length. See also: <a href="#setting-function-options">setting function options</a>. Reads exceeding this ceiling are <a href="#filtering">filtered out</a>. Default: <code>L,0,0.15</code>.</p> +<p>Sets a function governing the maximum number of ambiguous characters +(usually <code>N</code>s and/or <code>.</code>s) allowed in a read as a +function of read length. For instance, specifying <code>-L,0,0.15</code> +sets the N-ceiling function <code>f</code> to +<code>f(x) = 0 + 0.15 * x</code>, where x is the read length. See also: +<a href="#setting-function-options">setting function options</a>. Reads +exceeding this ceiling are <a href="#filtering">filtered out</a>. +Default: <code>L,0,0.15</code>.</p> </td> </tr> <tr> @@ -662,7 +1452,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--dpad <int></code></pre> </td> <td> -<p>"Pads" dynamic programming problems by <code><int></code> columns on either side to allow gaps. Default: 15.</p> +<p>"Pads" dynamic programming problems by <code><int></code> +columns on either side to allow gaps. Default: 15.</p> </td> </tr> <tr> @@ -670,7 +1461,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--gbar <int></code></pre> </td> <td> -<p>Disallow gaps within <code><int></code> positions of the beginning or end of the read. Default: 4.</p> +<p>Disallow gaps within <code><int></code> positions of the +beginning or end of the read. Default: 4.</p> </td> </tr> <tr> @@ -678,7 +1470,14 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--ignore-quals</code></pre> </td> <td> -<p>When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value. I.e. input is treated as though all quality values are high. This is also the default behavior when the input doesn't specify quality values (e.g. in <a href="#bowtie2-options-f"><code>-f</code></a>, <a href="#bowtie2-options-r"><code>-r</code></a>, or <a href="#bowtie2-options-c"><code>-c</code></a> modes).</p> +<p>When calculating a mismatch penalty, always consider the quality +value at the mismatched position to be the highest possible, regardless +of the actual value. I.e. input is treated as though all quality values +are high. This is also the default behavior when the input doesn't +specify quality values (e.g. in <a +href="#bowtie2-options-f"><code>-f</code></a>, <a +href="#bowtie2-options-r"><code>-r</code></a>, or <a +href="#bowtie2-options-c"><code>-c</code></a> modes).</p> </td> </tr> <tr> @@ -686,7 +1485,15 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--nofw/--norc</code></pre> </td> <td> -<p>If <code>--nofw</code> is specified, <code>bowtie2</code> will not attempt to align unpaired reads to the forward (Watson) reference strand. If <code>--norc</code> is specified, <code>bowtie2</code> will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, <code>--nofw</code> and <code>--norc</code> pertain to the fragments; i.e. specifying <code>--nofw</code> causes <code>bowtie2</code> to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default: both strands enabled.</p> +<p>If <code>--nofw</code> is specified, <code>bowtie2</code> will not +attempt to align unpaired reads to the forward (Watson) reference +strand. If <code>--norc</code> is specified, <code>bowtie2</code> will +not attempt to align unpaired reads against the reverse-complement +(Crick) reference strand. In paired-end mode, <code>--nofw</code> and +<code>--norc</code> pertain to the fragments; i.e. specifying +<code>--nofw</code> causes <code>bowtie2</code> to explore only those +paired-end configurations corresponding to fragments from the +reverse-complement (Crick) strand. Default: both strands enabled.</p> </td> </tr> <tr> @@ -694,7 +1501,24 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--no-1mm-upfront</code></pre> </td> <td> -<p>By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read <em>before</em> trying the <a href="#multiseed-heuristic">multiseed heuristic</a>. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the <a href="#multiseed-heuristic">multiseed heuristic</a>, like <a href="#bowtie2-options-L"><code>-L</code></a> and <a href="#bowtie2-options-N"><code>-N</code></a>. For instance, if the user specifies <code>-N 0</code> and <code>-L</code> equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the <a href="#multiseed-heuristic">multiseed heuristic</a>, which leads to the expected behavior when combined with options such as <a href="#bowtie2-options-L"><code>-L</code></a> and <a href="#bowtie2-options-N"><code>-N</code></a>. This comes at the expense of speed.</p> +<p>By default, Bowtie 2 will attempt to find either an exact or a +1-mismatch end-to-end alignment for the read <em>before</em> trying the +<a href="#multiseed-heuristic">multiseed heuristic</a>. Such alignments +can be found very quickly, and many short read alignments have exact or +near-exact end-to-end alignments. However, this can lead to unexpected +alignments when the user also sets options governing the <a +href="#multiseed-heuristic">multiseed heuristic</a>, like <a +href="#bowtie2-options-L"><code>-L</code></a> and <a +href="#bowtie2-options-N"><code>-N</code></a>. For instance, if the user +specifies <code>-N 0</code> and <code>-L</code> equal to the length of +the read, the user will be surprised to find 1-mismatch alignments +reported. This option prevents Bowtie 2 from searching for 1-mismatch +end-to-end alignments before using the <a +href="#multiseed-heuristic">multiseed heuristic</a>, which leads to the +expected behavior when combined with options such as <a +href="#bowtie2-options-L"><code>-L</code></a> and <a +href="#bowtie2-options-N"><code>-N</code></a>. This comes at the expense +of speed.</p> </td> </tr> <tr> @@ -702,7 +1526,14 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--end-to-end</code></pre> </td> <td> -<p>In this mode, Bowtie 2 requires that the entire read align from one end to the other, without any trimming (or "soft clipping") of characters from either end. The match bonus <a href="#bowtie2-options-ma"><code>--ma</code></a> always equals 0 in this mode, so all alignment scores are less than or equal to 0, and the greatest possible alignment score is 0. This is mutually exclusive with <a href="#bowtie2-options-local"><code>--local</code></a>. <code>--end-to-end</code> is the default mode.</p> +<p>In this mode, Bowtie 2 requires that the entire read align from one +end to the other, without any trimming (or "soft clipping") of +characters from either end. The match bonus <a +href="#bowtie2-options-ma"><code>--ma</code></a> always equals 0 in this +mode, so all alignment scores are less than or equal to 0, and the +greatest possible alignment score is 0. This is mutually exclusive with +<a href="#bowtie2-options-local"><code>--local</code></a>. +<code>--end-to-end</code> is the default mode.</p> </td> </tr> <tr> @@ -710,7 +1541,19 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--local</code></pre> </td> <td> -<p>In this mode, Bowtie 2 does not require that the entire read align from one end to the other. Rather, some characters may be omitted ("soft clipped") from the ends in order to achieve the greatest possible alignment score. The match bonus <a href="#bowtie2-options-ma"><code>--ma</code></a> is used in this mode, and the best possible alignment score is equal to the match bonus (<a href="#bowtie2-options-ma"><code>--ma</code></a>) times the length of the read. Specifying <code>--local</code> and one of the presets (e.g. <code>--local --very-fast</code>) is equivalent to specifying the local version of the preset (<code>--very-fast-local</code>). This is mutually exclusive with <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a>. <code>--end-to-end</code> is the default mode.</p> +<p>In this mode, Bowtie 2 does not require that the entire read align +from one end to the other. Rather, some characters may be omitted ("soft +clipped") from the ends in order to achieve the greatest possible +alignment score. The match bonus <a +href="#bowtie2-options-ma"><code>--ma</code></a> is used in this mode, +and the best possible alignment score is equal to the match bonus (<a +href="#bowtie2-options-ma"><code>--ma</code></a>) times the length of +the read. Specifying <code>--local</code> and one of the presets (e.g. +<code>--local --very-fast</code>) is equivalent to specifying the local +version of the preset (<code>--very-fast-local</code>). This is mutually +exclusive with <a +href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a>. +<code>--end-to-end</code> is the default mode.</p> </td> </tr> </table> @@ -721,7 +1564,13 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--ma <int></code></pre> </td> <td> -<p>Sets the match bonus. In <a href="#bowtie2-options-local"><code>--local</code></a> mode <code><int></code> is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode. Default: 2.</p> +<p>Sets the match bonus. In <a +href="#bowtie2-options-local"><code>--local</code></a> mode +<code><int></code> is added to the alignment score for each +position where a read character aligns to a reference character and the +characters match. Not used in <a +href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode. +Default: 2.</p> </td> </tr> <tr> @@ -729,7 +1578,18 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--mp MX,MN</code></pre> </td> <td> -<p>Sets the maximum (<code>MX</code>) and minimum (<code>MN</code>) mismatch penalties, both integers. A number less than or equal to <code>MX</code> and greater than or equal to <code>MN</code> is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an <code>N</code>. If <a href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a> is specified, the number subtracted quals <code>MX</code>. Otherwise, the number subtracted is <code>MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )</code> where Q is the Phred quality value. Default: <code>MX</code> = 6, <code>MN</code> = 2.</p> +<p>Sets the maximum (<code>MX</code>) and minimum (<code>MN</code>) +mismatch penalties, both integers. A number less than or equal to +<code>MX</code> and greater than or equal to <code>MN</code> is +subtracted from the alignment score for each position where a read +character aligns to a reference character, the characters do not match, +and neither is an <code>N</code>. If <a +href="#bowtie2-options-ignore-quals"><code>--ignore-quals</code></a> is +specified, the number subtracted quals <code>MX</code>. Otherwise, the +number subtracted is +<code>MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )</code> where Q is the +Phred quality value. Default: <code>MX</code> = 6, <code>MN</code> = +2.</p> </td> </tr> <tr> @@ -737,7 +1597,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--np <int></code></pre> </td> <td> -<p>Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as <code>N</code>. Default: 1.</p> +<p>Sets penalty for positions where the read, reference, or both, +contain an ambiguous character such as <code>N</code>. Default: 1.</p> </td> </tr> <tr> @@ -745,7 +1606,10 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--rdg <int1>,<int2></code></pre> </td> <td> -<p>Sets the read gap open (<code><int1></code>) and extend (<code><int2></code>) penalties. A read gap of length N gets a penalty of <code><int1></code> + N * <code><int2></code>. Default: 5, 3.</p> +<p>Sets the read gap open (<code><int1></code>) and extend +(<code><int2></code>) penalties. A read gap of length N gets a +penalty of <code><int1></code> + N * <code><int2></code>. +Default: 5, 3.</p> </td> </tr> <tr> @@ -753,7 +1617,10 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--rfg <int1>,<int2></code></pre> </td> <td> -<p>Sets the reference gap open (<code><int1></code>) and extend (<code><int2></code>) penalties. A reference gap of length N gets a penalty of <code><int1></code> + N * <code><int2></code>. Default: 5, 3.</p> +<p>Sets the reference gap open (<code><int1></code>) and extend +(<code><int2></code>) penalties. A reference gap of length N gets +a penalty of <code><int1></code> + N * <code><int2></code>. +Default: 5, 3.</p> </td> </tr> <tr> @@ -761,7 +1628,17 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--score-min <func></code></pre> </td> <td> -<p>Sets a function governing the minimum alignment score needed for an alignment to be considered "valid" (i.e. good enough to report). This is a function of read length. For instance, specifying <code>L,0,-0.6</code> sets the minimum-score function <code>f</code> to <code>f(x) = 0 + -0.6 * x</code>, where <code>x</code> is the read length. See also: <a href="#setting-function-options">setting function options</a>. The default in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode is <code>L,-0.6,-0.6</code> and the default in <a href="#bowtie2-options-local"><code>--local</code></a> mode is <code>G,20,8</code>.</p> +<p>Sets a function governing the minimum alignment score needed for an +alignment to be considered "valid" (i.e. good enough to report). This is +a function of read length. For instance, specifying +<code>L,0,-0.6</code> sets the minimum-score function <code>f</code> to +<code>f(x) = 0 + -0.6 * x</code>, where <code>x</code> is the read +length. See also: <a href="#setting-function-options">setting function +options</a>. The default in <a +href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode is +<code>L,-0.6,-0.6</code> and the default in <a +href="#bowtie2-options-local"><code>--local</code></a> mode is +<code>G,20,8</code>.</p> </td> </tr> </table> @@ -772,9 +1649,32 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-k <int></code></pre> </td> <td> -<p>By default, <code>bowtie2</code> searches for distinct, valid alignments for each read. When it finds a valid alignment, it continues looking for alignments that are nearly as good or better. The best alignment found is reported (randomly selected from among best if tied). Information about the best alignments is used to estimate mapping quality and to set SAM optional fields, such as <a href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a> and <a href="#bowtie2-build-opt-fields-xs"><code>XS:i</code></a>.</p> -<p>When <code>-k</code> is specified, however, <code>bowtie2</code> behaves differently. Instead, it searches for at most <code><int></code> distinct, valid alignments for each read. The search terminates when it can't find more distinct valid alignments, or when it finds <code><int></code>, whichever happens first. All alignments found are reported in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. For reads that have more than <code><int></code> distinct, valid alignments, <code>bowtie2</code> does not guarantee that the <code><int></code> alignments reported are the best possible in terms of alignment score. <code>-k</code> is mutually exclusive with <a href="#bowtie2-options-a"><code>-a</code></a>.</p> -<p>Note: Bowtie 2 is not designed with large values for <code>-k</code> in mind, and when aligning reads to long, repetitive genomes large <code>-k</code> can be very, very slow.</p> +<p>By default, <code>bowtie2</code> searches for distinct, valid +alignments for each read. When it finds a valid alignment, it continues +looking for alignments that are nearly as good or better. The best +alignment found is reported (randomly selected from among best if tied). +Information about the best alignments is used to estimate mapping +quality and to set SAM optional fields, such as <a +href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a> and <a +href="#bowtie2-build-opt-fields-xs"><code>XS:i</code></a>.</p> +<p>When <code>-k</code> is specified, however, <code>bowtie2</code> +behaves differently. Instead, it searches for at most +<code><int></code> distinct, valid alignments for each read. The +search terminates when it can't find more distinct valid alignments, or +when it finds <code><int></code>, whichever happens first. All +alignments found are reported in descending order by alignment score. +The alignment score for a paired-end alignment equals the sum of the +alignment scores of the individual mates. Each reported read or pair +alignment beyond the first has the SAM 'secondary' bit (which equals +256) set in its FLAGS field. For reads that have more than +<code><int></code> distinct, valid alignments, +<code>bowtie2</code> does not guarantee that the +<code><int></code> alignments reported are the best possible in +terms of alignment score. <code>-k</code> is mutually exclusive with <a +href="#bowtie2-options-a"><code>-a</code></a>.</p> +<p>Note: Bowtie 2 is not designed with large values for <code>-k</code> +in mind, and when aligning reads to long, repetitive genomes large +<code>-k</code> can be very, very slow.</p> </td> </tr> <tr> @@ -782,8 +1682,13 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-a</code></pre> </td> <td> -<p>Like <a href="#bowtie2-options-k"><code>-k</code></a> but with no upper limit on number of alignments to search for. <code>-a</code> is mutually exclusive with <a href="#bowtie2-options-k"><code>-k</code></a>.</p> -<p>Note: Bowtie 2 is not designed with <code>-a</code> mode in mind, and when aligning reads to long, repetitive genomes this mode can be very, very slow.</p> +<p>Like <a href="#bowtie2-options-k"><code>-k</code></a> but with no +upper limit on number of alignments to search for. <code>-a</code> is +mutually exclusive with <a +href="#bowtie2-options-k"><code>-k</code></a>.</p> +<p>Note: Bowtie 2 is not designed with <code>-a</code> mode in mind, and +when aligning reads to long, repetitive genomes this mode can be very, +very slow.</p> </td> </tr> </table> @@ -794,7 +1699,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-D <int></code></pre> </td> <td> -<p>Up to <code><int></code> consecutive seed extension attempts can "fail" before Bowtie 2 moves on, using the alignments found so far. A seed extension "fails" if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default: 15.</p> +<p>Up to <code><int></code> consecutive seed extension attempts +can "fail" before Bowtie 2 moves on, using the alignments found so far. +A seed extension "fails" if it does not yield a new best or a new +second-best alignment. This limit is automatically adjusted up when -k +or -a are specified. Default: 15.</p> </td> </tr> <tr> @@ -802,7 +1711,13 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-R <int></code></pre> </td> <td> -<p><code><int></code> is the maximum number of times Bowtie 2 will "re-seed" reads with repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default: 2.</p> +<p><code><int></code> is the maximum number of times Bowtie 2 will +"re-seed" reads with repetitive seeds. When "re-seeding," Bowtie 2 +simply chooses a new set of reads (same length, same number of +mismatches allowed) at different offsets and searches for more +alignments. A read is considered to have repetitive seeds if the total +number of seed hits divided by the number of seeds that aligned at least +once is greater than 300. Default: 2.</p> </td> </tr> </table> @@ -813,8 +1728,25 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-I/--minins <int></code></pre> </td> <td> -<p>The minimum fragment length for valid paired-end alignments. E.g. if <code>-I 60</code> is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as <a href="#bowtie2-options-X"><code>-X</code></a> is also satisfied). A 19-bp gap would not be valid in that case. If trimming options <a href="#bowtie2-options-3"><code>-3</code></a> or <a href="#bowtie2-options-5"><code>-5</code></a> are also used, the <a href="#bowtie2-options-I"><code>-I</code></a> constraint is applied with respect to the untrimmed mates.</p> -<p>The larger the difference between <a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a>, the slower Bowtie 2 will run. This is because larger differences between <a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a> require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient.</p> +<p>The minimum fragment length for valid paired-end alignments. E.g. if +<code>-I 60</code> is specified and a paired-end alignment consists of +two 20-bp alignments in the appropriate orientation with a 20-bp gap +between them, that alignment is considered valid (as long as <a +href="#bowtie2-options-X"><code>-X</code></a> is also satisfied). A +19-bp gap would not be valid in that case. If trimming options <a +href="#bowtie2-options-3"><code>-3</code></a> or <a +href="#bowtie2-options-5"><code>-5</code></a> are also used, the <a +href="#bowtie2-options-I"><code>-I</code></a> constraint is applied with +respect to the untrimmed mates.</p> +<p>The larger the difference between <a +href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a>, the slower Bowtie 2 will +run. This is because larger differences between <a +href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a> require that Bowtie 2 scan +a larger window to determine if a concordant alignment exists. For +typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is +very efficient.</p> <p>Default: 0 (essentially imposing no minimum)</p> </td> </tr> @@ -823,8 +1755,25 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-X/--maxins <int></code></pre> </td> <td> -<p>The maximum fragment length for valid paired-end alignments. E.g. if <code>-X 100</code> is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as <a href="#bowtie2-options-I"><code>-I</code></a> is also satisfied). A 61-bp gap would not be valid in that case. If trimming options <a href="#bowtie2-options-3"><code>-3</code></a> or <a href="#bowtie2-options-5"><code>-5</code></a> are also used, the <code>-X</code> constraint is applied with respect to the untrimmed mates, not the trimmed mates.</p> -<p>The larger the difference between <a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a>, the slower Bowtie 2 will run. This is because larger differences between <a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a> require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient.</p> +<p>The maximum fragment length for valid paired-end alignments. E.g. if +<code>-X 100</code> is specified and a paired-end alignment consists of +two 20-bp alignments in the proper orientation with a 60-bp gap between +them, that alignment is considered valid (as long as <a +href="#bowtie2-options-I"><code>-I</code></a> is also satisfied). A +61-bp gap would not be valid in that case. If trimming options <a +href="#bowtie2-options-3"><code>-3</code></a> or <a +href="#bowtie2-options-5"><code>-5</code></a> are also used, the +<code>-X</code> constraint is applied with respect to the untrimmed +mates, not the trimmed mates.</p> +<p>The larger the difference between <a +href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a>, the slower Bowtie 2 will +run. This is because larger differences between <a +href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a> require that Bowtie 2 scan +a larger window to determine if a concordant alignment exists. For +typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is +very efficient.</p> <p>Default: 500.</p> </td> </tr> @@ -833,7 +1782,20 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--fr/--rf/--ff</code></pre> </td> <td> -<p>The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. E.g., if <code>--fr</code> is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (<a href="#bowtie2-options-I"><code>-I</code></a> and <a href="#bowtie2-options-X"><code>-X</code></a>) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. <code>--rf</code> likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. <code>--ff</code> requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented. Default: <code>--fr</code> (appropriate for Illumina's Paired-end Sequencing Assay).</p> +<p>The upstream/downstream mate orientations for a valid paired-end +alignment against the forward reference strand. E.g., if +<code>--fr</code> is specified and there is a candidate paired-end +alignment where mate 1 appears upstream of the reverse complement of +mate 2 and the fragment length constraints (<a +href="#bowtie2-options-I"><code>-I</code></a> and <a +href="#bowtie2-options-X"><code>-X</code></a>) are met, that alignment +is valid. Also, if mate 2 appears upstream of the reverse complement of +mate 1 and all other constraints are met, that too is valid. +<code>--rf</code> likewise requires that an upstream mate1 be +reverse-complemented and a downstream mate2 be forward-oriented. +<code>--ff</code> requires both an upstream mate 1 and a downstream mate +2 to be forward-oriented. Default: <code>--fr</code> (appropriate for +Illumina's Paired-end Sequencing Assay).</p> </td> </tr> <tr> @@ -841,7 +1803,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--no-mixed</code></pre> </td> <td> -<p>By default, when <code>bowtie2</code> cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates. This option disables that behavior.</p> +<p>By default, when <code>bowtie2</code> cannot find a concordant or +discordant alignment for a pair, it then tries to find alignments for +the individual mates. This option disables that behavior.</p> </td> </tr> <tr> @@ -849,7 +1813,14 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--no-discordant</code></pre> </td> <td> -<p>By default, <code>bowtie2</code> looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (<a href="#bowtie2-options-fr"><code>--fr</code>/<code>--rf</code>/<code>--ff</code></a>, <a href="#bowtie2-options-I"><code>-I</code></a>, <a href="#bowtie2-options-X"><code>-X</code></a>). This option disables that behavior.</p> +<p>By default, <code>bowtie2</code> looks for discordant alignments if +it cannot find any concordant alignments. A discordant alignment is an +alignment where both mates align uniquely, but that does not satisfy the +paired-end constraints (<a +href="#bowtie2-options-fr"><code>--fr</code>/<code>--rf</code>/<code>--ff</code></a>, +<a href="#bowtie2-options-I"><code>-I</code></a>, <a +href="#bowtie2-options-X"><code>-X</code></a>). This option disables +that behavior.</p> </td> </tr> <tr> @@ -857,7 +1828,12 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--dovetail</code></pre> </td> <td> -<p>If the mates "dovetail", that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: <a href="#mates-can-overlap-contain-or-dovetail-each-other">Mates can overlap, contain or dovetail each other</a>. Default: mates cannot dovetail in a concordant alignment.</p> +<p>If the mates "dovetail", that is if one mate alignment extends past +the beginning of the other such that the wrong mate begins upstream, +consider that to be concordant. See also: <a +href="#mates-can-overlap-contain-or-dovetail-each-other">Mates can +overlap, contain or dovetail each other</a>. Default: mates cannot +dovetail in a concordant alignment.</p> </td> </tr> <tr> @@ -865,7 +1841,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--no-contain</code></pre> </td> <td> -<p>If one mate alignment contains the other, consider that to be non-concordant. See also: <a href="#mates-can-overlap-contain-or-dovetail-each-other">Mates can overlap, contain or dovetail each other</a>. Default: a mate can contain the other in a concordant alignment.</p> +<p>If one mate alignment contains the other, consider that to be +non-concordant. See also: <a +href="#mates-can-overlap-contain-or-dovetail-each-other">Mates can +overlap, contain or dovetail each other</a>. Default: a mate can contain +the other in a concordant alignment.</p> </td> </tr> <tr> @@ -873,7 +1853,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--no-overlap</code></pre> </td> <td> -<p>If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: <a href="#mates-can-overlap-contain-or-dovetail-each-other">Mates can overlap, contain or dovetail each other</a>. Default: mates can overlap in a concordant alignment.</p> +<p>If one mate alignment overlaps the other at all, consider that to be +non-concordant. See also: <a +href="#mates-can-overlap-contain-or-dovetail-each-other">Mates can +overlap, contain or dovetail each other</a>. Default: mates can overlap +in a concordant alignment.</p> </td> </tr> </table> @@ -884,7 +1868,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--align-paired-reads</code></pre> </td> <td> -<p>Bowtie 2 will, by default, attempt to align unpaired BAM reads. Use this option to align paired-end reads instead.</p> +<p>Bowtie 2 will, by default, attempt to align unpaired BAM reads. Use +this option to align paired-end reads instead.</p> </td> </tr> <tr> @@ -892,7 +1877,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--preserve-tags</code></pre> </td> <td> -<p>Preserve tags from the original BAM record by appending them to the end of the corresponding Bowtie 2 SAM output.</p> +<p>Preserve tags from the original BAM record by appending them to the +end of the corresponding Bowtie 2 SAM output.</p> </td> </tr> </table> @@ -903,7 +1889,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-t/--time</code></pre> </td> <td> -<p>Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. Default: off.</p> +<p>Print the wall-clock time required to load the index files and align +the reads. This is printed to the "standard error" ("stderr") +filehandle. Default: off.</p> </td> </tr> <tr> @@ -914,7 +1902,17 @@ Seed 4 rc: TTATGCATGA</code></pre> --un-lz4 <path></code></pre> </td> <td> -<p>Write unpaired reads that fail to align to file at <code><path></code>. These reads correspond to the SAM records with the FLAGS <code>0x4</code> bit set and neither the <code>0x40</code> nor <code>0x80</code> bits set. If <code>--un-gz</code> is specified, output will be gzip compressed. If <code>--un-bz2</code> or <code>--un-lz4</code> is specified, output will be bzip2 or lz4 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.</p> +<p>Write unpaired reads that fail to align to file at +<code><path></code>. These reads correspond to the SAM records +with the FLAGS <code>0x4</code> bit set and neither the +<code>0x40</code> nor <code>0x80</code> bits set. If +<code>--un-gz</code> is specified, output will be gzip compressed. If +<code>--un-bz2</code> or <code>--un-lz4</code> is specified, output will +be bzip2 or lz4 compressed. Reads written in this way will appear +exactly as they did in the input file, without any modification (same +sequence, same name, same quality string, same quality encoding). Reads +will not necessarily appear in the same order as they did in the +input.</p> </td> </tr> <tr> @@ -925,7 +1923,17 @@ Seed 4 rc: TTATGCATGA</code></pre> --al-lz4 <path></code></pre> </td> <td> -<p>Write unpaired reads that align at least once to file at <code><path></code>. These reads correspond to the SAM records with the FLAGS <code>0x4</code>, <code>0x40</code>, and <code>0x80</code> bits unset. If <code>--al-gz</code> is specified, output will be gzip compressed. If <code>--al-bz2</code> is specified, output will be bzip2 compressed. Similarly if <code>--al-lz4</code> is specified, output will be lz4 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.</p> +<p>Write unpaired reads that align at least once to file at +<code><path></code>. These reads correspond to the SAM records +with the FLAGS <code>0x4</code>, <code>0x40</code>, and +<code>0x80</code> bits unset. If <code>--al-gz</code> is specified, +output will be gzip compressed. If <code>--al-bz2</code> is specified, +output will be bzip2 compressed. Similarly if <code>--al-lz4</code> is +specified, output will be lz4 compressed. Reads written in this way will +appear exactly as they did in the input file, without any modification +(same sequence, same name, same quality string, same quality encoding). +Reads will not necessarily appear in the same order as they did in the +input.</p> </td> </tr> <tr> @@ -936,7 +1944,20 @@ Seed 4 rc: TTATGCATGA</code></pre> --un-conc-lz4 <path></code></pre> </td> <td> -<p>Write paired-end reads that fail to align concordantly to file(s) at <code><path></code>. These reads correspond to the SAM records with the FLAGS <code>0x4</code> bit set and either the <code>0x40</code> or <code>0x80</code> bit set (depending on whether it's mate #1 or #2). <code>.1</code> and <code>.2</code> strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, <code>%</code>, is used in <code><path></code>, the percent symbol is replaced with <code>1</code> or <code>2</code> to make the per-mate filenames. Otherwise, <code>.1</code> or <code>.2</code> are added before the final dot in <code><path></code> to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.</p> +<p>Write paired-end reads that fail to align concordantly to file(s) at +<code><path></code>. These reads correspond to the SAM records +with the FLAGS <code>0x4</code> bit set and either the <code>0x40</code> +or <code>0x80</code> bit set (depending on whether it's mate #1 or #2). +<code>.1</code> and <code>.2</code> strings are added to the filename to +distinguish which file contains mate #1 and mate #2. If a percent +symbol, <code>%</code>, is used in <code><path></code>, the +percent symbol is replaced with <code>1</code> or <code>2</code> to make +the per-mate filenames. Otherwise, <code>.1</code> or <code>.2</code> +are added before the final dot in <code><path></code> to make the +per-mate filenames. Reads written in this way will appear exactly as +they did in the input files, without any modification (same sequence, +same name, same quality string, same quality encoding). Reads will not +necessarily appear in the same order as they did in the inputs.</p> </td> </tr> <tr> @@ -947,7 +1968,21 @@ Seed 4 rc: TTATGCATGA</code></pre> --al-conc-lz4 <path></code></pre> </td> <td> -<p>Write paired-end reads that align concordantly at least once to file(s) at <code><path></code>. These reads correspond to the SAM records with the FLAGS <code>0x4</code> bit unset and either the <code>0x40</code> or <code>0x80</code> bit set (depending on whether it's mate #1 or #2). <code>.1</code> and <code>.2</code> strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, <code>%</code>, is used in <code><path></code>, the percent symbol is replaced with <code>1</code> or <code>2</code> to make the per-mate filenames. Otherwise, <code>.1</code> or <code>.2</code> are added before the final dot in <code><path></code> to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.</p> +<p>Write paired-end reads that align concordantly at least once to +file(s) at <code><path></code>. These reads correspond to the SAM +records with the FLAGS <code>0x4</code> bit unset and either the +<code>0x40</code> or <code>0x80</code> bit set (depending on whether +it's mate #1 or #2). <code>.1</code> and <code>.2</code> strings are +added to the filename to distinguish which file contains mate #1 and +mate #2. If a percent symbol, <code>%</code>, is used in +<code><path></code>, the percent symbol is replaced with +<code>1</code> or <code>2</code> to make the per-mate filenames. +Otherwise, <code>.1</code> or <code>.2</code> are added before the final +dot in <code><path></code> to make the per-mate filenames. Reads +written in this way will appear exactly as they did in the input files, +without any modification (same sequence, same name, same quality string, +same quality encoding). Reads will not necessarily appear in the same +order as they did in the inputs.</p> </td> </tr> <tr> @@ -963,7 +1998,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--met-file <path></code></pre> </td> <td> -<p>Write <code>bowtie2</code> metrics to file <code><path></code>. Having alignment metric can be useful for debugging certain problems, especially performance issues. See also: <a href="#bowtie2-options-met"><code>--met</code></a>. Default: metrics disabled.</p> +<p>Write <code>bowtie2</code> metrics to file <code><path></code>. +Having alignment metric can be useful for debugging certain problems, +especially performance issues. See also: <a +href="#bowtie2-options-met"><code>--met</code></a>. Default: metrics +disabled.</p> </td> </tr> <tr> @@ -971,7 +2010,13 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--met-stderr <path></code></pre> </td> <td> -<p>Write <code>bowtie2</code> metrics to the "standard error" ("stderr") filehandle. This is not mutually exclusive with <a href="#bowtie2-options-met-file"><code>--met-file</code></a>. Having alignment metric can be useful for debugging certain problems, especially performance issues. See also: <a href="#bowtie2-options-met"><code>--met</code></a>. Default: metrics disabled.</p> +<p>Write <code>bowtie2</code> metrics to the "standard error" ("stderr") +filehandle. This is not mutually exclusive with <a +href="#bowtie2-options-met-file"><code>--met-file</code></a>. Having +alignment metric can be useful for debugging certain problems, +especially performance issues. See also: <a +href="#bowtie2-options-met"><code>--met</code></a>. Default: metrics +disabled.</p> </td> </tr> <tr> @@ -979,7 +2024,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--met <int></code></pre> </td> <td> -<p>Write a new <code>bowtie2</code> metrics record every <code><int></code> seconds. Only matters if either <a href="#bowtie2-options-met-stderr"><code>--met-stderr</code></a> or <a href="#bowtie2-options-met-file"><code>--met-file</code></a> are specified. Default: 1.</p> +<p>Write a new <code>bowtie2</code> metrics record every +<code><int></code> seconds. Only matters if either <a +href="#bowtie2-options-met-stderr"><code>--met-stderr</code></a> or <a +href="#bowtie2-options-met-file"><code>--met-file</code></a> are +specified. Default: 1.</p> </td> </tr> </table> @@ -1014,7 +2063,12 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--rg-id <text></code></pre> </td> <td> -<p>Set the read group ID to <code><text></code>. This causes the SAM <code>@RG</code> header line to be printed, with <code><text></code> as the value associated with the <code>ID:</code> tag. It also causes the <code>RG:Z:</code> extra field to be attached to each SAM output record, with value set to <code><text></code>.</p> +<p>Set the read group ID to <code><text></code>. This causes the +SAM <code>@RG</code> header line to be printed, with +<code><text></code> as the value associated with the +<code>ID:</code> tag. It also causes the <code>RG:Z:</code> extra field +to be attached to each SAM output record, with value set to +<code><text></code>.</p> </td> </tr> <tr> @@ -1022,7 +2076,16 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--rg <text></code></pre> </td> <td> -<p>Add <code><text></code> (usually of the form <code>TAG:VAL</code>, e.g. <code>SM:Pool1</code>) as a field on the <code>@RG</code> header line. Note: in order for the <code>@RG</code> line to appear, <a href="#bowtie2-options-rg-id"><code>--rg-id</code></a> must also be specified. This is because the <code>ID</code> tag is required by the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM Spec</a>. Specify <code>--rg</code> multiple times to set multiple fields. See the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM Spec</a> for details about what fields are legal.</p> +<p>Add <code><text></code> (usually of the form +<code>TAG:VAL</code>, e.g. <code>SM:Pool1</code>) as a field on the +<code>@RG</code> header line. Note: in order for the <code>@RG</code> +line to appear, <a +href="#bowtie2-options-rg-id"><code>--rg-id</code></a> must also be +specified. This is because the <code>ID</code> tag is required by the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM Spec</a>. Specify +<code>--rg</code> multiple times to set multiple fields. See the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM Spec</a> for details +about what fields are legal.</p> </td> </tr> <tr> @@ -1030,7 +2093,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--omit-sec-seq</code></pre> </td> <td> -<p>When printing secondary alignments, Bowtie 2 by default will write out the <code>SEQ</code> and <code>QUAL</code> strings. Specifying this option causes Bowtie 2 to print an asterisk in those fields instead.</p> +<p>When printing secondary alignments, Bowtie 2 by default will write +out the <code>SEQ</code> and <code>QUAL</code> strings. Specifying this +option causes Bowtie 2 to print an asterisk in those fields instead.</p> </td> </tr> <tr> @@ -1038,7 +2103,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--soft-clipped-unmapped-tlen</code></pre> </td> <td> -<p>Consider soft-clipped bases unmapped when calculating <code>TLEN</code>. Only available in <a href="#bowtie2-options-local"><code>--local</code></a> mode.</p> +<p>Consider soft-clipped bases unmapped when calculating +<code>TLEN</code>. Only available in <a +href="#bowtie2-options-local"><code>--local</code></a> mode.</p> </td> </tr> <tr> @@ -1046,7 +2113,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--sam-no-qname-trunc</code></pre> </td> <td> -<p>Suppress standard behavior of truncating readname at first whitespace at the expense of generating non-standard SAM</p> +<p>Suppress standard behavior of truncating readname at first whitespace +at the expense of generating non-standard SAM</p> </td> </tr> <tr> @@ -1054,7 +2122,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--xeq</code></pre> </td> <td> -<p>Use <code>'='/'X'</code>, instead of <code>'M'</code>, to specify matches/mismatches in SAM record</p> +<p>Use <code>'='/'X'</code>, instead of <code>'M'</code>, to specify +matches/mismatches in SAM record</p> </td> </tr> <tr> @@ -1062,7 +2131,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--sam-append-comment</code></pre> </td> <td> -<p>Append FASTA/FASTQ comment to SAM record, where a comment is everything after the first space in the read name.</p> +<p>Append FASTA/FASTQ comment to SAM record, where a comment is +everything after the first space in the read name.</p> </td> </tr> </table> @@ -1073,7 +2143,12 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-o/--offrate <int></code></pre> </td> <td> -<p>Override the offrate of the index with <code><int></code>. If <code><int></code> is greater than the offrate used to build the index, then some row markings are discarded when the index is read into memory. This reduces the memory footprint of the aligner but requires more time to calculate text offsets. <code><int></code> must be greater than the value used to build the index.</p> +<p>Override the offrate of the index with <code><int></code>. If +<code><int></code> is greater than the offrate used to build the +index, then some row markings are discarded when the index is read into +memory. This reduces the memory footprint of the aligner but requires +more time to calculate text offsets. <code><int></code> must be +greater than the value used to build the index.</p> </td> </tr> <tr> @@ -1081,7 +2156,16 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-p/--threads NTHREADS</code></pre> </td> <td> -<p>Launch <code>NTHREADS</code> parallel search threads (default: 1). Threads will run on separate processors/cores and synchronize when parsing reads and outputting alignments. Searching for alignments is highly parallel, and speedup is close to linear. Increasing <code>-p</code> increases Bowtie 2's memory footprint. E.g. when aligning to a human genome index, increasing <code>-p</code> from 1 to 8 increases the memory footprint by a few hundred megabytes. This option is only available if <code>bowtie</code> is linked with the <code>pthreads</code> library (i.e. if <code>BOWTIE_PTHREADS=0</code> is not specified at build time).</p> +<p>Launch <code>NTHREADS</code> parallel search threads (default: 1). +Threads will run on separate processors/cores and synchronize when +parsing reads and outputting alignments. Searching for alignments is +highly parallel, and speedup is close to linear. Increasing +<code>-p</code> increases Bowtie 2's memory footprint. E.g. when +aligning to a human genome index, increasing <code>-p</code> from 1 to 8 +increases the memory footprint by a few hundred megabytes. This option +is only available if <code>bowtie</code> is linked with the +<code>pthreads</code> library (i.e. if <code>BOWTIE_PTHREADS=0</code> is +not specified at build time).</p> </td> </tr> <tr> @@ -1089,7 +2173,15 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--reorder</code></pre> </td> <td> -<p>Guarantees that output SAM records are printed in an order corresponding to the order of the reads in the original input file, even when <a href="#bowtie2-options-p"><code>-p</code></a> is set greater than 1. Specifying <code>--reorder</code> and setting <a href="#bowtie2-options-p"><code>-p</code></a> greater than 1 causes Bowtie 2 to run somewhat slower and use somewhat more memory than if <code>--reorder</code> were not specified. Has no effect if <a href="#bowtie2-options-p"><code>-p</code></a> is set to 1, since output order will naturally correspond to input order in that case.</p> +<p>Guarantees that output SAM records are printed in an order +corresponding to the order of the reads in the original input file, even +when <a href="#bowtie2-options-p"><code>-p</code></a> is set greater +than 1. Specifying <code>--reorder</code> and setting <a +href="#bowtie2-options-p"><code>-p</code></a> greater than 1 causes +Bowtie 2 to run somewhat slower and use somewhat more memory than if +<code>--reorder</code> were not specified. Has no effect if <a +href="#bowtie2-options-p"><code>-p</code></a> is set to 1, since output +order will naturally correspond to input order in that case.</p> </td> </tr> <tr> @@ -1097,7 +2189,13 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--mm</code></pre> </td> <td> -<p>Use memory-mapped I/O to load the index, rather than typical file I/O. Memory-mapping allows many concurrent <code>bowtie</code> processes on the same computer to share the same memory image of the index (i.e. you pay the memory overhead just once). This facilitates memory-efficient parallelization of <code>bowtie</code> in situations where using <a href="#bowtie2-options-p"><code>-p</code></a> is not possible or not preferable.</p> +<p>Use memory-mapped I/O to load the index, rather than typical file +I/O. Memory-mapping allows many concurrent <code>bowtie</code> processes +on the same computer to share the same memory image of the index (i.e. +you pay the memory overhead just once). This facilitates +memory-efficient parallelization of <code>bowtie</code> in situations +where using <a href="#bowtie2-options-p"><code>-p</code></a> is not +possible or not preferable.</p> </td> </tr> </table> @@ -1108,7 +2206,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--qc-filter</code></pre> </td> <td> -<p>Filter out reads for which the QSEQ filter field is non-zero. Only has an effect when read format is <a href="#bowtie2-options-qseq"><code>--qseq</code></a>. Default: off.</p> +<p>Filter out reads for which the QSEQ filter field is non-zero. Only +has an effect when read format is <a +href="#bowtie2-options-qseq"><code>--qseq</code></a>. Default: off.</p> </td> </tr> <tr> @@ -1116,7 +2216,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--seed <int></code></pre> </td> <td> -<p>Use <code><int></code> as the seed for pseudo-random number generator. Default: 0.</p> +<p>Use <code><int></code> as the seed for pseudo-random number +generator. Default: 0.</p> </td> </tr> <tr> @@ -1124,7 +2225,19 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--non-deterministic</code></pre> </td> <td> -<p>Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It seeds the generator with a number derived from (a) the read name, (b) the nucleotide sequence, (c) the quality sequence, (d) the value of the <a href="#bowtie2-options-seed"><code>--seed</code></a> option. This means that if two reads are identical (same name, same nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s) for both, even if there was ambiguity. When <code>--non-deterministic</code> is specified, Bowtie 2 re-initializes its pseudo-random generator for each read using the current time. This means that Bowtie 2 will not necessarily report the same alignment for two identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads.</p> +<p>Normally, Bowtie 2 re-initializes its pseudo-random generator for +each read. It seeds the generator with a number derived from (a) the +read name, (b) the nucleotide sequence, (c) the quality sequence, (d) +the value of the <a href="#bowtie2-options-seed"><code>--seed</code></a> +option. This means that if two reads are identical (same name, same +nucleotides, same qualities) Bowtie 2 will find and report the same +alignment(s) for both, even if there was ambiguity. When +<code>--non-deterministic</code> is specified, Bowtie 2 re-initializes +its pseudo-random generator for each read using the current time. This +means that Bowtie 2 will not necessarily report the same alignment for +two identical reads. This is counter-intuitive for some users, but might +be more appropriate in situations where the input consists of many +identical reads.</p> </td> </tr> <tr> @@ -1145,12 +2258,30 @@ Seed 4 rc: TTATGCATGA</code></pre> </tr> </table> <h2 id="sam-output">SAM output</h2> -<p>Following is a brief description of the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> format as output by <code>bowtie2</code>. For more details, see the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM format specification</a>.</p> -<p>By default, <code>bowtie2</code> prints a SAM header with <code>@HD</code>, <code>@SQ</code> and <code>@PG</code> lines. When one or more <a href="#bowtie2-options-rg"><code>--rg</code></a> arguments are specified, <code>bowtie2</code> will also print an <code>@RG</code> line that includes all user-specified <a href="#bowtie2-options-rg"><code>--rg</code></a> tokens separated by tabs.</p> -<p>Each subsequent line describes an alignment or, if the read failed to align, a read. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are:</p> +<p>Following is a brief description of the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a> format as output +by <code>bowtie2</code>. For more details, see the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM format +specification</a>.</p> +<p>By default, <code>bowtie2</code> prints a SAM header with +<code>@HD</code>, <code>@SQ</code> and <code>@PG</code> lines. When one +or more <a href="#bowtie2-options-rg"><code>--rg</code></a> arguments +are specified, <code>bowtie2</code> will also print an <code>@RG</code> +line that includes all user-specified <a +href="#bowtie2-options-rg"><code>--rg</code></a> tokens separated by +tabs.</p> +<p>Each subsequent line describes an alignment or, if the read failed to +align, a read. Each line is a collection of at least 12 fields separated +by tabs; from left to right, the fields are:</p> <ol type="1"> <li><p>Name of read that aligned.</p> -<p>Note that the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> disallows whitespace in the read name. If the read name contains any whitespace characters, Bowtie 2 will truncate the name at the first whitespace character. This is similar to the behavior of other tools. The standard behavior of truncating at the first whitespace can be suppressed with <code>--sam-no-qname-trunc</code> at the expense of generating non-standard SAM.</p></li> +<p>Note that the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM +specification</a> disallows whitespace in the read name. If the read +name contains any whitespace characters, Bowtie 2 will truncate the name +at the first whitespace character. This is similar to the behavior of +other tools. The standard behavior of truncating at the first whitespace +can be suppressed with <code>--sam-no-qname-trunc</code> at the expense +of generating non-standard SAM.</p></li> <li><p>Sum of all applicable flags. Flags relevant to Bowtie are:</p> <table> <tr> @@ -1198,7 +2329,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>32</code></pre> </td> <td> -<p>The other mate in the paired-end alignment is aligned to the reverse reference strand</p> +<p>The other mate in the paired-end alignment is aligned to the reverse +reference strand</p> </td> </tr> <tr> @@ -1218,17 +2350,36 @@ Seed 4 rc: TTATGCATGA</code></pre> </td> </tr> </table> -<p>Thus, an unpaired read that aligns to the reverse reference strand will have flag 16. A paired-end read that aligns and is the first mate in the pair will have flag 83 (= 64 + 16 + 2 + 1).</p></li> +<p>Thus, an unpaired read that aligns to the reverse reference strand +will have flag 16. A paired-end read that aligns and is the first mate +in the pair will have flag 83 (= 64 + 16 + 2 + 1).</p></li> <li><p>Name of reference sequence where alignment occurs</p></li> -<li><p>1-based offset into the forward reference strand where leftmost character of the alignment occurs</p></li> +<li><p>1-based offset into the forward reference strand where leftmost +character of the alignment occurs</p></li> <li><p>Mapping quality</p></li> <li><p>CIGAR string representation of alignment</p></li> -<li><p>Name of reference sequence where mate's alignment occurs. Set to <code>=</code> if the mate's reference sequence is the same as this alignment's, or <code>*</code> if there is no mate.</p></li> -<li><p>1-based offset into the forward reference strand where leftmost character of the mate's alignment occurs. Offset is 0 if there is no mate.</p></li> -<li><p>Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome.</p></li> -<li><p>Read sequence (reverse-complemented if aligned to the reverse strand)</p></li> -<li><p>ASCII-encoded read qualities (reverse-complemented if the read aligned to the reverse strand). The encoded quality values are on the <a href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred quality</a> scale and the encoding is ASCII-offset by 33 (ASCII char <code>!</code>), similarly to a <a href="http://en.wikipedia.org/wiki/FASTQ_format">FASTQ</a> file.</p></li> -<li><p>Optional fields. Fields are tab-separated. <code>bowtie2</code> outputs zero or more of these optional fields for each alignment, depending on the type of the alignment:</p></li> +<li><p>Name of reference sequence where mate's alignment occurs. Set to +<code>=</code> if the mate's reference sequence is the same as this +alignment's, or <code>*</code> if there is no mate.</p></li> +<li><p>1-based offset into the forward reference strand where leftmost +character of the mate's alignment occurs. Offset is 0 if there is no +mate.</p></li> +<li><p>Inferred fragment length. Size is negative if the mate's +alignment occurs upstream of this alignment. Size is 0 if the mates did +not align concordantly. However, size is non-0 if the mates aligned +discordantly to the same chromosome.</p></li> +<li><p>Read sequence (reverse-complemented if aligned to the reverse +strand)</p></li> +<li><p>ASCII-encoded read qualities (reverse-complemented if the read +aligned to the reverse strand). The encoded quality values are on the <a +href="http://en.wikipedia.org/wiki/Phred_quality_score">Phred +quality</a> scale and the encoding is ASCII-offset by 33 (ASCII char +<code>!</code>), similarly to a <a +href="http://en.wikipedia.org/wiki/FASTQ_format">FASTQ</a> +file.</p></li> +<li><p>Optional fields. Fields are tab-separated. <code>bowtie2</code> +outputs zero or more of these optional fields for each alignment, +depending on the type of the alignment:</p></li> </ol> <table> <tr> @@ -1236,7 +2387,10 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>AS:i:<N></code></pre> </td> <td> -<p>Alignment score. Can be negative. Can be greater than 0 in <a href="#bowtie2-options-local"><code>--local</code></a> mode (but not in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode). Only present if SAM record is for an aligned read.</p> +<p>Alignment score. Can be negative. Can be greater than 0 in <a +href="#bowtie2-options-local"><code>--local</code></a> mode (but not in +<a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> +mode). Only present if SAM record is for an aligned read.</p> </td> </tr> <tr> @@ -1244,7 +2398,14 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>XS:i:<N></code></pre> </td> <td> -<p>Alignment score for the best-scoring alignment found other than the alignment reported. Can be negative. Can be greater than 0 in <a href="#bowtie2-options-local"><code>--local</code></a> mode (but not in <a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> mode). Only present if the SAM record is for an aligned read and more than one alignment was found for the read. Note that, when the read is part of a concordantly-aligned pair, this score could be greater than <a href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a>.</p> +<p>Alignment score for the best-scoring alignment found other than the +alignment reported. Can be negative. Can be greater than 0 in <a +href="#bowtie2-options-local"><code>--local</code></a> mode (but not in +<a href="#bowtie2-options-end-to-end"><code>--end-to-end</code></a> +mode). Only present if the SAM record is for an aligned read and more +than one alignment was found for the read. Note that, when the read is +part of a concordantly-aligned pair, this score could be greater than <a +href="#bowtie2-build-opt-fields-as"><code>AS:i</code></a>.</p> </td> </tr> <tr> @@ -1252,7 +2413,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>YS:i:<N></code></pre> </td> <td> -<p>Alignment score for opposite mate in the paired-end alignment. Only present if the SAM record is for a read that aligned as part of a paired-end alignment.</p> +<p>Alignment score for opposite mate in the paired-end alignment. Only +present if the SAM record is for a read that aligned as part of a +paired-end alignment.</p> </td> </tr> <tr> @@ -1260,7 +2423,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>XN:i:<N></code></pre> </td> <td> -<p>The number of ambiguous bases in the reference covering this alignment. Only present if SAM record is for an aligned read.</p> +<p>The number of ambiguous bases in the reference covering this +alignment. Only present if SAM record is for an aligned read.</p> </td> </tr> <tr> @@ -1268,7 +2432,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>XM:i:<N></code></pre> </td> <td> -<p>The number of mismatches in the alignment. Only present if SAM record is for an aligned read.</p> +<p>The number of mismatches in the alignment. Only present if SAM record +is for an aligned read.</p> </td> </tr> <tr> @@ -1276,7 +2441,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>XO:i:<N></code></pre> </td> <td> -<p>The number of gap opens, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.</p> +<p>The number of gap opens, for both read and reference gaps, in the +alignment. Only present if SAM record is for an aligned read.</p> </td> </tr> <tr> @@ -1284,7 +2450,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>XG:i:<N></code></pre> </td> <td> -<p>The number of gap extensions, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.</p> +<p>The number of gap extensions, for both read and reference gaps, in +the alignment. Only present if SAM record is for an aligned read.</p> </td> </tr> <tr> @@ -1292,7 +2459,10 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>NM:i:<N></code></pre> </td> <td> -<p>The edit distance; that is, the minimal number of one-nucleotide edits (substitutions, insertions and deletions) needed to transform the read string into the reference string. Only present if SAM record is for an aligned read.</p> +<p>The edit distance; that is, the minimal number of one-nucleotide +edits (substitutions, insertions and deletions) needed to transform the +read string into the reference string. Only present if SAM record is for +an aligned read.</p> </td> </tr> <tr> @@ -1300,7 +2470,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>YF:Z:<S></code></pre> </td> <td> -<p>String indicating reason why the read was filtered out. See also: <a href="#filtering">Filtering</a>. Only appears for reads that were filtered out.</p> +<p>String indicating reason why the read was filtered out. See also: <a +href="#filtering">Filtering</a>. Only appears for reads that were +filtered out.</p> </td> </tr> <tr> @@ -1308,7 +2480,12 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>YT:Z:<S></code></pre> </td> <td> -<p>Value of <code>UU</code> indicates the read was not part of a pair. Value of <code>CP</code> indicates the read was part of a pair and the pair aligned concordantly. Value of <code>DP</code> indicates the read was part of a pair and the pair aligned discordantly. Value of <code>UP</code> indicates the read was part of a pair but the pair failed to aligned either concordantly or discordantly.</p> +<p>Value of <code>UU</code> indicates the read was not part of a pair. +Value of <code>CP</code> indicates the read was part of a pair and the +pair aligned concordantly. Value of <code>DP</code> indicates the read +was part of a pair and the pair aligned discordantly. Value of +<code>UP</code> indicates the read was part of a pair but the pair +failed to aligned either concordantly or discordantly.</p> </td> </tr> <tr> @@ -1316,17 +2493,68 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>MD:Z:<S></code></pre> </td> <td> -<p>A string representation of the mismatched reference bases in the alignment. See <a href="https://samtools.github.io/hts-specs/SAMtags.pdf">SAM Tags format specification</a> for details. Only present if SAM record is for an aligned read.</p> +<p>A string representation of the mismatched reference bases in the +alignment. See <a +href="https://samtools.github.io/hts-specs/SAMtags.pdf">SAM Tags format +specification</a> for details. Only present if SAM record is for an +aligned read.</p> </td> </tr> </table> -<h1 id="the-bowtie2-build-indexer">The <code>bowtie2-build</code> indexer</h1> -<p><code>bowtie2-build</code> builds a Bowtie index from a set of DNA sequences. <code>bowtie2-build</code> outputs a set of 6 files with suffixes <code>.1.bt2</code>, <code>.2.bt2</code>, <code>.3.bt2</code>, <code>.4.bt2</code>, <code>.rev.1.bt2</code>, and <code>.rev.2.bt2</code>. In the case of a large index these suffixes will have a <code>bt2l</code> termination. These files together constitute the index: they are all that is needed to align reads to that reference. The original sequence <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files are no longer used by Bowtie 2 once the index is built.</p> -<p>Bowtie 2's <code>.bt2</code> index format is different from Bowtie 1's <code>.ebwt</code> format, and they are not compatible with each other.</p> -<p>Use of Karkkainen's <a href="http://portal.acm.org/citation.cfm?id=1314852">blockwise algorithm</a> allows <code>bowtie2-build</code> to trade off between running time and memory usage. <code>bowtie2-build</code> has three options governing how it makes this trade: <a href="#bowtie2-build-options-p"><code>-p</code>/<code>--packed</code></a>, <a href="#bowtie2-build-options-bmax"><code>--bmax</code></a>/<a href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a>, and <a href="#bowtie2-build-options-dcv"><code>--dcv</code></a>. By default, <code>bowtie2-build</code> will automatically search for the settings that yield the best running time without exhausting memory. This behavior can be disabled using the <a href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> option.</p> -<p>The indexer provides options pertaining to the "shape" of the index, e.g. <a href="#bowtie2-build-options-o"><code>--offrate</code></a> governs the fraction of <a href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> rows that are "marked" (i.e., the density of the suffix-array sample; see the original <a href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> paper for details). All of these options are potentially profitable trade-offs depending on the application. They have been set to defaults that are reasonable for most cases according to our experiments. See <a href="#performance-tuning">Performance tuning</a> for details.</p> -<p><code>bowtie2-build</code> can generate either <a href="#small-and-large-indexes">small or large indexes</a>. The wrapper will decide which based on the length of the input genome. If the reference does not exceed 4 billion characters but a large index is preferred, the user can specify <a href="#bowtie2-build-options-large-index"><code>--large-index</code></a> to force <code>bowtie2-build</code> to build a large index instead.</p> -<p>The Bowtie 2 index is based on the <a href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> of Ferragina and Manzini, which in turn is based on the <a href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> transform. The algorithm used to build the index is based on the <a href="http://portal.acm.org/citation.cfm?id=1314852">blockwise algorithm</a> of Karkkainen.</p> +<h1 id="the-bowtie2-build-indexer">The <code>bowtie2-build</code> +indexer</h1> +<p><code>bowtie2-build</code> builds a Bowtie index from a set of DNA +sequences. <code>bowtie2-build</code> outputs a set of 6 files with +suffixes <code>.1.bt2</code>, <code>.2.bt2</code>, <code>.3.bt2</code>, +<code>.4.bt2</code>, <code>.rev.1.bt2</code>, and +<code>.rev.2.bt2</code>. In the case of a large index these suffixes +will have a <code>bt2l</code> termination. These files together +constitute the index: they are all that is needed to align reads to that +reference. The original sequence <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files +are no longer used by Bowtie 2 once the index is built.</p> +<p>Bowtie 2's <code>.bt2</code> index format is different from Bowtie +1's <code>.ebwt</code> format, and they are not compatible with each +other.</p> +<p>Use of Karkkainen's <a +href="http://portal.acm.org/citation.cfm?id=1314852">blockwise +algorithm</a> allows <code>bowtie2-build</code> to trade off between +running time and memory usage. <code>bowtie2-build</code> has three +options governing how it makes this trade: <a +href="#bowtie2-build-options-p"><code>-p</code>/<code>--packed</code></a>, +<a href="#bowtie2-build-options-bmax"><code>--bmax</code></a>/<a +href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a>, and +<a href="#bowtie2-build-options-dcv"><code>--dcv</code></a>. By default, +<code>bowtie2-build</code> will automatically search for the settings +that yield the best running time without exhausting memory. This +behavior can be disabled using the <a +href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> +option.</p> +<p>The indexer provides options pertaining to the "shape" of the index, +e.g. <a href="#bowtie2-build-options-o"><code>--offrate</code></a> +governs the fraction of <a +href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> +rows that are "marked" (i.e., the density of the suffix-array sample; +see the original <a +href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> paper +for details). All of these options are potentially profitable trade-offs +depending on the application. They have been set to defaults that are +reasonable for most cases according to our experiments. See <a +href="#performance-tuning">Performance tuning</a> for details.</p> +<p><code>bowtie2-build</code> can generate either <a +href="#small-and-large-indexes">small or large indexes</a>. The wrapper +will decide which based on the length of the input genome. If the +reference does not exceed 4 billion characters but a large index is +preferred, the user can specify <a +href="#bowtie2-build-options-large-index"><code>--large-index</code></a> +to force <code>bowtie2-build</code> to build a large index instead.</p> +<p>The Bowtie 2 index is based on the <a +href="http://portal.acm.org/citation.cfm?id=796543">FM Index</a> of +Ferragina and Manzini, which in turn is based on the <a +href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> +transform. The algorithm used to build the index is based on the <a +href="http://portal.acm.org/citation.cfm?id=1314852">blockwise +algorithm</a> of Karkkainen.</p> <h2 id="command-line-1">Command Line</h2> <p>Usage:</p> <pre><code>bowtie2-build [options]* <reference_in> <bt2_base></code></pre> @@ -1337,7 +2565,14 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code><reference_in></code></pre> </td> <td> -<p>A comma-separated list of <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files containing the reference sequences to be aligned to, or, if <a href="#bowtie2-build-options-c"><code>-c</code></a> is specified, the sequences themselves. E.g., <code><reference_in></code> might be <code>chr1.fa,chr2.fa,chrX.fa,chrY.fa</code>, or, if <a href="#bowtie2-build-options-c"><code>-c</code></a> is specified, this might be <code>GGTCATCCT,ACGGGTCGT,CCGTTCTATGCGGCTTA</code>.</p> +<p>A comma-separated list of <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files +containing the reference sequences to be aligned to, or, if <a +href="#bowtie2-build-options-c"><code>-c</code></a> is specified, the +sequences themselves. E.g., <code><reference_in></code> might be +<code>chr1.fa,chr2.fa,chrX.fa,chrY.fa</code>, or, if <a +href="#bowtie2-build-options-c"><code>-c</code></a> is specified, this +might be <code>GGTCATCCT,ACGGGTCGT,CCGTTCTATGCGGCTTA</code>.</p> </td> </tr> <tr> @@ -1345,7 +2580,12 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code><bt2_base></code></pre> </td> <td> -<p>The basename of the index files to write. By default, <code>bowtie2-build</code> writes files named <code>NAME.1.bt2</code>, <code>NAME.2.bt2</code>, <code>NAME.3.bt2</code>, <code>NAME.4.bt2</code>, <code>NAME.rev.1.bt2</code>, and <code>NAME.rev.2.bt2</code>, where <code>NAME</code> is <code><bt2_base></code>.</p> +<p>The basename of the index files to write. By default, +<code>bowtie2-build</code> writes files named <code>NAME.1.bt2</code>, +<code>NAME.2.bt2</code>, <code>NAME.3.bt2</code>, +<code>NAME.4.bt2</code>, <code>NAME.rev.1.bt2</code>, and +<code>NAME.rev.2.bt2</code>, where <code>NAME</code> is +<code><bt2_base></code>.</p> </td> </tr> </table> @@ -1356,7 +2596,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-f</code></pre> </td> <td> -<p>The reference input files (specified as <code><reference_in></code>) are <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files (usually having extension <code>.fa</code>, <code>.mfa</code>, <code>.fna</code> or similar).</p> +<p>The reference input files (specified as +<code><reference_in></code>) are <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files +(usually having extension <code>.fa</code>, <code>.mfa</code>, +<code>.fna</code> or similar).</p> </td> </tr> <tr> @@ -1364,7 +2608,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-c</code></pre> </td> <td> -<p>The reference sequences are given on the command line. I.e. <code><reference_in></code> is a comma-separated list of sequences rather than a list of <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files.</p> +<p>The reference sequences are given on the command line. I.e. +<code><reference_in></code> is a comma-separated list of sequences +rather than a list of <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> +files.</p> </td> </tr> <tr> @@ -1372,7 +2620,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--large-index</code></pre> </td> <td> -<p>Force <code>bowtie2-build</code> to build a <a href="#small-and-large-indexes">large index</a>, even if the reference is less than ~ 4 billion nucleotides inlong.</p> +<p>Force <code>bowtie2-build</code> to build a <a +href="#small-and-large-indexes">large index</a>, even if the reference +is less than ~ 4 billion nucleotides inlong.</p> </td> </tr> <tr> @@ -1380,7 +2630,14 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-a/--noauto</code></pre> </td> <td> -<p>Disable the default behavior whereby <code>bowtie2-build</code> automatically selects values for the <a href="#bowtie2-build-options-bmax"><code>--bmax</code></a>, <a href="#bowtie2-build-options-dcv"><code>--dcv</code></a> and <a href="#bowtie2-build-options-p"><code>--packed</code></a> parameters according to available memory. Instead, user may specify values for those parameters. If memory is exhausted during indexing, an error message will be printed; it is up to the user to try new parameters.</p> +<p>Disable the default behavior whereby <code>bowtie2-build</code> +automatically selects values for the <a +href="#bowtie2-build-options-bmax"><code>--bmax</code></a>, <a +href="#bowtie2-build-options-dcv"><code>--dcv</code></a> and <a +href="#bowtie2-build-options-p"><code>--packed</code></a> parameters +according to available memory. Instead, user may specify values for +those parameters. If memory is exhausted during indexing, an error +message will be printed; it is up to the user to try new parameters.</p> </td> </tr> <tr> @@ -1388,7 +2645,11 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-p/--packed</code></pre> </td> <td> -<p>Use a packed (2-bits-per-nucleotide) representation for DNA strings. This saves memory but makes indexing 2-3 times slower. Default: off. This is configured automatically by default; use <a href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> to configure manually.</p> +<p>Use a packed (2-bits-per-nucleotide) representation for DNA strings. +This saves memory but makes indexing 2-3 times slower. Default: off. +This is configured automatically by default; use <a +href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> +to configure manually.</p> </td> </tr> <tr> @@ -1396,7 +2657,18 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--bmax <int></code></pre> </td> <td> -<p>The maximum number of suffixes allowed in a block. Allowing more suffixes per block makes indexing faster, but increases peak memory usage. Setting this option overrides any previous setting for <a href="#bowtie2-build-options-bmax"><code>--bmax</code></a>, or <a href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a>. Default (in terms of the <a href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a> parameter) is <a href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a> 4 * number of threads. This is configured automatically by default; use <a href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> to configure manually.</p> +<p>The maximum number of suffixes allowed in a block. Allowing more +suffixes per block makes indexing faster, but increases peak memory +usage. Setting this option overrides any previous setting for <a +href="#bowtie2-build-options-bmax"><code>--bmax</code></a>, or <a +href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a>. +Default (in terms of the <a +href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a> +parameter) is <a +href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a> 4 * +number of threads. This is configured automatically by default; use <a +href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> +to configure manually.</p> </td> </tr> <tr> @@ -1404,7 +2676,16 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--bmaxdivn <int></code></pre> </td> <td> -<p>The maximum number of suffixes allowed in a block, expressed as a fraction of the length of the reference. Setting this option overrides any previous setting for <a href="#bowtie2-build-options-bmax"><code>--bmax</code></a>, or <a href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a>. Default: <a href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a> 4 * number of threads. This is configured automatically by default; use <a href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> to configure manually.</p> +<p>The maximum number of suffixes allowed in a block, expressed as a +fraction of the length of the reference. Setting this option overrides +any previous setting for <a +href="#bowtie2-build-options-bmax"><code>--bmax</code></a>, or <a +href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a>. +Default: <a +href="#bowtie2-build-options-bmaxdivn"><code>--bmaxdivn</code></a> 4 * +number of threads. This is configured automatically by default; use <a +href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> +to configure manually.</p> </td> </tr> <tr> @@ -1412,7 +2693,13 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--dcv <int></code></pre> </td> <td> -<p>Use <code><int></code> as the period for the difference-cover sample. A larger period yields less memory overhead, but may make suffix sorting slower, especially if repeats are present. Must be a power of 2 no greater than 4096. Default: 1024. This is configured automatically by default; use <a href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> to configure manually.</p> +<p>Use <code><int></code> as the period for the difference-cover +sample. A larger period yields less memory overhead, but may make suffix +sorting slower, especially if repeats are present. Must be a power of 2 +no greater than 4096. Default: 1024. This is configured automatically by +default; use <a +href="#bowtie2-build-options-a"><code>-a</code>/<code>--noauto</code></a> +to configure manually.</p> </td> </tr> <tr> @@ -1420,7 +2707,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--nodc</code></pre> </td> <td> -<p>Disable use of the difference-cover sample. Suffix sorting becomes quadratic-time in the worst case (where the worst case is an extremely repetitive reference). Default: off.</p> +<p>Disable use of the difference-cover sample. Suffix sorting becomes +quadratic-time in the worst case (where the worst case is an extremely +repetitive reference). Default: off.</p> </td> </tr> <tr> @@ -1428,7 +2717,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-r/--noref</code></pre> </td> <td> -<p>Do not build the <code>NAME.3.bt2</code> and <code>NAME.4.bt2</code> portions of the index, which contain a bitpacked version of the reference sequences and are used for paired-end alignment.</p> +<p>Do not build the <code>NAME.3.bt2</code> and <code>NAME.4.bt2</code> +portions of the index, which contain a bitpacked version of the +reference sequences and are used for paired-end alignment.</p> </td> </tr> <tr> @@ -1436,7 +2727,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-3/--justref</code></pre> </td> <td> -<p>Build only the <code>NAME.3.bt2</code> and <code>NAME.4.bt2</code> portions of the index, which contain a bitpacked version of the reference sequences and are used for paired-end alignment.</p> +<p>Build only the <code>NAME.3.bt2</code> and <code>NAME.4.bt2</code> +portions of the index, which contain a bitpacked version of the +reference sequences and are used for paired-end alignment.</p> </td> </tr> <tr> @@ -1444,7 +2737,16 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-o/--offrate <int></code></pre> </td> <td> -<p>To map alignments back to positions on the reference sequences, it's necessary to annotate ("mark") some or all of the <a href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> rows with their corresponding location on the genome. <a href="#bowtie2-build-options-o"><code>-o</code>/<code>--offrate</code></a> governs how many rows get marked: the indexer will mark every 2^<code><int></code> rows. Marking more rows makes reference-position lookups faster, but requires more memory to hold the annotations at runtime. The default is 5 (every 32nd row is marked; for human genome, annotations occupy about 340 megabytes).</p> +<p>To map alignments back to positions on the reference sequences, it's +necessary to annotate ("mark") some or all of the <a +href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> +rows with their corresponding location on the genome. <a +href="#bowtie2-build-options-o"><code>-o</code>/<code>--offrate</code></a> +governs how many rows get marked: the indexer will mark every +2^<code><int></code> rows. Marking more rows makes +reference-position lookups faster, but requires more memory to hold the +annotations at runtime. The default is 5 (every 32nd row is marked; for +human genome, annotations occupy about 340 megabytes).</p> </td> </tr> <tr> @@ -1452,7 +2754,13 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-t/--ftabchars <int></code></pre> </td> <td> -<p>The ftab is the lookup table used to calculate an initial <a href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> range with respect to the first <code><int></code> characters of the query. A larger <code><int></code> yields a larger lookup table but faster query times. The ftab has size 4^(<code><int></code>+1) bytes. The default setting is 10 (ftab is 4MB).</p> +<p>The ftab is the lookup table used to calculate an initial <a +href="http://en.wikipedia.org/wiki/Burrows-Wheeler_transform">Burrows-Wheeler</a> +range with respect to the first <code><int></code> characters of +the query. A larger <code><int></code> yields a larger lookup +table but faster query times. The ftab has size +4^(<code><int></code>+1) bytes. The default setting is 10 (ftab is +4MB).</p> </td> </tr> <tr> @@ -1460,7 +2768,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--seed <int></code></pre> </td> <td> -<p>Use <code><int></code> as the seed for pseudo-random number generator.</p> +<p>Use <code><int></code> as the seed for pseudo-random number +generator.</p> </td> </tr> <tr> @@ -1468,7 +2777,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--cutoff <int></code></pre> </td> <td> -<p>Index only the first <code><int></code> bases of the reference sequences (cumulative across sequences) and ignore the rest.</p> +<p>Index only the first <code><int></code> bases of the reference +sequences (cumulative across sequences) and ignore the rest.</p> </td> </tr> <tr> @@ -1476,7 +2786,8 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-q/--quiet</code></pre> </td> <td> -<p><code>bowtie2-build</code> is verbose by default. With this option <code>bowtie2-build</code> will print only error messages.</p> +<p><code>bowtie2-build</code> is verbose by default. With this option +<code>bowtie2-build</code> will print only error messages.</p> </td> </tr> <tr> @@ -1484,7 +2795,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>--threads <int></code></pre> </td> <td> -<p>By default <code>bowtie2-build</code> is using only one thread. Increasing the number of threads will speed up the index building considerably in most cases.</p> +<p>By default <code>bowtie2-build</code> is using only one thread. +Increasing the number of threads will speed up the index building +considerably in most cases.</p> </td> </tr> <tr> @@ -1504,8 +2817,20 @@ Seed 4 rc: TTATGCATGA</code></pre> </td> </tr> </table> -<h1 id="the-bowtie2-inspect-index-inspector">The <code>bowtie2-inspect</code> index inspector</h1> -<p><code>bowtie2-inspect</code> extracts information from a Bowtie index about what kind of index it is and what reference sequences were used to build it. When run without any options, the tool will output a <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> file containing the sequences of the original references (with all non-<code>A</code>/<code>C</code>/<code>G</code>/<code>T</code> characters converted to <code>N</code>s). It can also be used to extract just the reference sequence names using the <a href="#bowtie2-inspect-options-n"><code>-n</code>/<code>--names</code></a> option or a more verbose summary using the <a href="#bowtie2-inspect-options-s"><code>-s</code>/<code>--summary</code></a> option.</p> +<h1 id="the-bowtie2-inspect-index-inspector">The +<code>bowtie2-inspect</code> index inspector</h1> +<p><code>bowtie2-inspect</code> extracts information from a Bowtie index +about what kind of index it is and what reference sequences were used to +build it. When run without any options, the tool will output a <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> file +containing the sequences of the original references (with all +non-<code>A</code>/<code>C</code>/<code>G</code>/<code>T</code> +characters converted to <code>N</code>s). It can also be used to extract +just the reference sequence names using the <a +href="#bowtie2-inspect-options-n"><code>-n</code>/<code>--names</code></a> +option or a more verbose summary using the <a +href="#bowtie2-inspect-options-s"><code>-s</code>/<code>--summary</code></a> +option.</p> <h2 id="command-line-2">Command Line</h2> <p>Usage:</p> <pre><code>bowtie2-inspect [options]* <bt2_base></code></pre> @@ -1516,7 +2841,12 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code><bt2_base></code></pre> </td> <td> -<p>The basename of the index to be inspected. The basename is name of any of the index files but with the <code>.X.bt2</code> or <code>.rev.X.bt2</code> suffix omitted. <code>bowtie2-inspect</code> first looks in the current directory for the index files, then in the directory specified in the <code>BOWTIE2_INDEXES</code> environment variable.</p> +<p>The basename of the index to be inspected. The basename is name of +any of the index files but with the <code>.X.bt2</code> or +<code>.rev.X.bt2</code> suffix omitted. <code>bowtie2-inspect</code> +first looks in the current directory for the index files, then in the +directory specified in the <code>BOWTIE2_INDEXES</code> environment +variable.</p> </td> </tr> </table> @@ -1527,7 +2857,10 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-a/--across <int></code></pre> </td> <td> -<p>When printing <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> output, output a newline character every <code><int></code> bases (default: 60).</p> +<p>When printing <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> +output, output a newline character every <code><int></code> bases +(default: 60).</p> </td> </tr> <tr> @@ -1543,7 +2876,9 @@ Seed 4 rc: TTATGCATGA</code></pre> <pre><code>-s/--summary</code></pre> </td> <td> -<p>Print a summary that includes information about index settings, as well as the names and lengths of the input sequences. The summary has this format:</p> +<p>Print a summary that includes information about index settings, as +well as the names and lengths of the input sequences. The summary has +this format:</p> <pre><code>Colorspace <0 or 1> SA-Sample 1 in <sample> FTab-Chars <chars> @@ -1551,7 +2886,8 @@ Sequence-1 <name> <len> Sequence-2 <name> <len> ... Sequence-N <name> <len></code></pre> -<p>Fields are separated by tabs. Colorspace is always set to 0 for Bowtie 2.</p> +<p>Fields are separated by tabs. Colorspace is always set to 0 for +Bowtie 2.</p> </td> </tr> <tr> @@ -1587,18 +2923,59 @@ Sequence-N <name> <len></code></pre> </td> </tr> </table> -<h1 id="getting-started-with-bowtie-2-lambda-phage-example">Getting started with Bowtie 2: Lambda phage example</h1> -<p>Bowtie 2 comes with some example files to get you started. The example files are not scientifically significant; we use the <a href="http://en.wikipedia.org/wiki/Lambda_phage">Lambda phage</a> reference genome simply because it's short, and the reads were generated by a computer program, not a sequencer. However, these files will let you start running Bowtie 2 and downstream tools right away.</p> -<p>First follow the manual instructions to <a href="#obtaining-bowtie-2">obtain Bowtie 2</a>. Set the <code>BT2_HOME</code> environment variable to point to the new Bowtie 2 directory containing the <code>bowtie2</code>, <code>bowtie2-build</code> and <code>bowtie2-inspect</code> binaries. This is important, as the <code>BT2_HOME</code> variable is used in the commands below to refer to that directory.</p> +<h1 id="getting-started-with-bowtie-2-lambda-phage-example">Getting +started with Bowtie 2: Lambda phage example</h1> +<p>Bowtie 2 comes with some example files to get you started. The +example files are not scientifically significant; we use the <a +href="http://en.wikipedia.org/wiki/Lambda_phage">Lambda phage</a> +reference genome simply because it's short, and the reads were generated +by a computer program, not a sequencer. However, these files will let +you start running Bowtie 2 and downstream tools right away.</p> +<p>First follow the manual instructions to <a +href="#obtaining-bowtie-2">obtain Bowtie 2</a>. Set the +<code>BT2_HOME</code> environment variable to point to the new Bowtie 2 +directory containing the <code>bowtie2</code>, +<code>bowtie2-build</code> and <code>bowtie2-inspect</code> binaries. +This is important, as the <code>BT2_HOME</code> variable is used in the +commands below to refer to that directory.</p> <h2 id="indexing-a-reference-genome">Indexing a reference genome</h2> -<p>To create an index for the <a href="http://en.wikipedia.org/wiki/Lambda_phage">Lambda phage</a> reference genome included with Bowtie 2, create a new temporary directory (it doesn't matter where), change into that directory, and run:</p> +<p>To create an index for the <a +href="http://en.wikipedia.org/wiki/Lambda_phage">Lambda phage</a> +reference genome included with Bowtie 2, create a new temporary +directory (it doesn't matter where), change into that directory, and +run:</p> <pre><code>$BT2_HOME/bowtie2-build $BT2_HOME/example/reference/lambda_virus.fa lambda_virus</code></pre> -<p>The command should print many lines of output then quit. When the command completes, the current directory will contain four new files that all start with <code>lambda_virus</code> and end with <code>.1.bt2</code>, <code>.2.bt2</code>, <code>.3.bt2</code>, <code>.4.bt2</code>, <code>.rev.1.bt2</code>, and <code>.rev.2.bt2</code>. These files constitute the index - you're done!</p> -<p>You can use <code>bowtie2-build</code> to create an index for a set of <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files obtained from any source, including sites such as <a href="http://genome.ucsc.edu/cgi-bin/hgGateway">UCSC</a>, <a href="http://www.ncbi.nlm.nih.gov/sites/genome">NCBI</a>, and <a href="http://www.ensembl.org/">Ensembl</a>. When indexing multiple <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files, specify all the files using commas to separate file names. For more details on how to create an index with <code>bowtie2-build</code>, see the <a href="#the-bowtie2-build-indexer">manual section on index building</a>. You may also want to bypass this process by obtaining a pre-built index. See <a href="#using-a-pre-built-index">using a pre-built index</a> below for an example.</p> +<p>The command should print many lines of output then quit. When the +command completes, the current directory will contain four new files +that all start with <code>lambda_virus</code> and end with +<code>.1.bt2</code>, <code>.2.bt2</code>, <code>.3.bt2</code>, +<code>.4.bt2</code>, <code>.rev.1.bt2</code>, and +<code>.rev.2.bt2</code>. These files constitute the index - you're +done!</p> +<p>You can use <code>bowtie2-build</code> to create an index for a set +of <a href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> +files obtained from any source, including sites such as <a +href="http://genome.ucsc.edu/cgi-bin/hgGateway">UCSC</a>, <a +href="http://www.ncbi.nlm.nih.gov/sites/genome">NCBI</a>, and <a +href="http://www.ensembl.org/">Ensembl</a>. When indexing multiple <a +href="https://en.wikipedia.org/wiki/FASTA"><code>FASTA</code></a> files, +specify all the files using commas to separate file names. For more +details on how to create an index with <code>bowtie2-build</code>, see +the <a href="#the-bowtie2-build-indexer">manual section on index +building</a>. You may also want to bypass this process by obtaining a +pre-built index. See <a href="#using-a-pre-built-index">using a +pre-built index</a> below for an example.</p> <h2 id="aligning-example-reads">Aligning example reads</h2> -<p>Stay in the directory created in the previous step, which now contains the <code>lambda_virus</code> index files. Next, run:</p> +<p>Stay in the directory created in the previous step, which now +contains the <code>lambda_virus</code> index files. Next, run:</p> <pre><code>$BT2_HOME/bowtie2 -x lambda_virus -U $BT2_HOME/example/reads/reads_1.fq -S eg1.sam</code></pre> -<p>This runs the Bowtie 2 aligner, which aligns a set of unpaired reads to the <a href="http://en.wikipedia.org/wiki/Lambda_phage">Lambda phage</a> reference genome using the index generated in the previous step. The alignment results in SAM format are written to the file <code>eg1.sam</code>, and a short alignment summary is written to the console. (Actually, the summary is written to the "standard error" or "stderr" filehandle, which is typically printed to the console.)</p> +<p>This runs the Bowtie 2 aligner, which aligns a set of unpaired reads +to the <a href="http://en.wikipedia.org/wiki/Lambda_phage">Lambda +phage</a> reference genome using the index generated in the previous +step. The alignment results in SAM format are written to the file +<code>eg1.sam</code>, and a short alignment summary is written to the +console. (Actually, the summary is written to the "standard error" or +"stderr" filehandle, which is typically printed to the console.)</p> <p>To see the first few lines of the SAM output, run:</p> <pre><code>head eg1.sam</code></pre> <p>You will see something like this:</p> @@ -1612,28 +2989,61 @@ r4 0 gi|9626243|ref|NC_001416.1| 40075 42 184M * 0 0 GGGCCAATGCGC r5 0 gi|9626243|ref|NC_001416.1| 48010 42 138M * 0 0 GTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTT 9''%<D)A03E1-*7=),:F/0!6,D9:H,<9D%:0B(%'E,(8EFG$E89B$27G8F*2+4,-!,0D5()&=(FGG:5;3*@/.0F-G#5#3->('FDFEG?)5.!)"AGADB3?6(@H(:B<>6!>;>6>G,."?% AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:138 YT:Z:UU r6 16 gi|9626243|ref|NC_001416.1| 41607 42 72M2D119M * 0 0 TCGATTTGCAAATACCGGAACATCTCGGTAACTGCATATTCTGCATTAAAAAATCAACGCAAAAAATCGGACGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATNCCATGTGCGTGACGGNCATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAATGTCGCT 1H#G;H"$E*E#&"*)2%66?=9/9'=;4)4/>@%+5#@#$4A*!<D=="8#1*A9BA=:(1+#C&.#(3#H=9E)AC*5,AC#E'536*2?)H14?>9'B=7(3H/B:+A:8%1-+#(E%&$$&14"76D?>7(&20H5%*&CF8!G5B+A4F$7(:"'?0$?G+$)B-?2<0<F=D!38BH,%=8&5@+ AS:i:-13 XN:i:0 XM:i:2 XO:i:1 XG:i:2 NM:i:4 MD:Z:72^TT55C15A47 YT:Z:UU r7 16 gi|9626243|ref|NC_001416.1| 4692 42 143M * 0 0 TCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATCGCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACAGCATTCTGCTCGATATGGACANGCCCGGCGGGATGGTGGCGGGG -"/@*7A0)>2,AAH@&"%B)*5*23B/,)90.B@%=FE,E063C9?,:26$-0:,.,1849'4.;F>FA;76+5&$<C":$!A*,<B,<)@<'85D%C*:)30@85;?.B$05=@95DCDH<53!8G:F:B7/A.E':434> AS:i:-6 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:98G21C22 YT:Z:UU</code></pre> -<p>The first few lines (beginning with <code>@</code>) are SAM header lines, and the rest of the lines are SAM alignments, one line per read or mate. See the <a href="#sam-output">Bowtie 2 manual section on SAM output</a> and the <a href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> for details about how to interpret the SAM file format.</p> +<p>The first few lines (beginning with <code>@</code>) are SAM header +lines, and the rest of the lines are SAM alignments, one line per read +or mate. See the <a href="#sam-output">Bowtie 2 manual section on SAM +output</a> and the <a +href="http://samtools.sourceforge.net/SAM1.pdf">SAM specification</a> +for details about how to interpret the SAM file format.</p> <h2 id="paired-end-example">Paired-end example</h2> -<p>To align paired-end reads included with Bowtie 2, stay in the same directory and run:</p> +<p>To align paired-end reads included with Bowtie 2, stay in the same +directory and run:</p> <pre><code>$BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam</code></pre> -<p>This aligns a set of paired-end reads to the reference genome, with results written to the file <code>eg2.sam</code>.</p> +<p>This aligns a set of paired-end reads to the reference genome, with +results written to the file <code>eg2.sam</code>.</p> <h2 id="local-alignment-example-1">Local alignment example</h2> -<p>To use <a href="#end-to-end-alignment-versus-local-alignment">local alignment</a> to align some longer reads included with Bowtie 2, stay in the same directory and run:</p> +<p>To use <a href="#end-to-end-alignment-versus-local-alignment">local +alignment</a> to align some longer reads included with Bowtie 2, stay in +the same directory and run:</p> <pre><code>$BT2_HOME/bowtie2 --local -x lambda_virus -U $BT2_HOME/example/reads/longreads.fq -S eg3.sam</code></pre> -<p>This aligns the long reads to the reference genome using local alignment, with results written to the file <code>eg3.sam</code>.</p> -<h2 id="using-samtoolsbcftools-downstream">Using SAMtools/BCFtools downstream</h2> -<p><a href="http://samtools.sourceforge.net">SAMtools</a> is a collection of tools for manipulating and analyzing SAM and BAM alignment files. <a href="http://samtools.sourceforge.net/mpileup.shtml">BCFtools</a> is a collection of tools for calling variants and manipulating VCF and BCF files, and it is typically distributed with <a href="http://samtools.sourceforge.net">SAMtools</a>. Using these tools together allows you to get from alignments in SAM format to variant calls in VCF format. This example assumes that <code>samtools</code> and <code>bcftools</code> are installed and that the directories containing these binaries are in your <a href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH environment variable</a>.</p> +<p>This aligns the long reads to the reference genome using local +alignment, with results written to the file <code>eg3.sam</code>.</p> +<h2 id="using-samtoolsbcftools-downstream">Using SAMtools/BCFtools +downstream</h2> +<p><a href="http://samtools.sourceforge.net">SAMtools</a> is a +collection of tools for manipulating and analyzing SAM and BAM alignment +files. <a +href="http://samtools.sourceforge.net/mpileup.shtml">BCFtools</a> is a +collection of tools for calling variants and manipulating VCF and BCF +files, and it is typically distributed with <a +href="http://samtools.sourceforge.net">SAMtools</a>. Using these tools +together allows you to get from alignments in SAM format to variant +calls in VCF format. This example assumes that <code>samtools</code> and +<code>bcftools</code> are installed and that the directories containing +these binaries are in your <a +href="http://en.wikipedia.org/wiki/PATH_(variable)">PATH environment +variable</a>.</p> <p>Run the paired-end example:</p> <pre><code>$BT2_HOME/bowtie2 -x $BT2_HOME/example/index/lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam</code></pre> -<p>Use <code>samtools view</code> to convert the SAM file into a BAM file. BAM is the binary format corresponding to the SAM text format. Run:</p> +<p>Use <code>samtools view</code> to convert the SAM file into a BAM +file. BAM is the binary format corresponding to the SAM text format. +Run:</p> <pre><code>samtools view -bS eg2.sam > eg2.bam</code></pre> -<p>Use <code>samtools sort</code> to convert the BAM file to a sorted BAM file.</p> +<p>Use <code>samtools sort</code> to convert the BAM file to a sorted +BAM file.</p> <pre><code>samtools sort eg2.bam -o eg2.sorted.bam</code></pre> -<p>We now have a sorted BAM file called <code>eg2.sorted.bam</code>. Sorted BAM is a useful format because the alignments are (a) compressed, which is convenient for long-term storage, and (b) sorted, which is conveneint for variant discovery. To generate variant calls in VCF format, run:</p> +<p>We now have a sorted BAM file called <code>eg2.sorted.bam</code>. +Sorted BAM is a useful format because the alignments are (a) compressed, +which is convenient for long-term storage, and (b) sorted, which is +conveneint for variant discovery. To generate variant calls in VCF +format, run:</p> <pre><code>bcftools mpileup -f $BT2_HOME/example/reference/lambda_virus.fa eg2.sorted.bam | bcftools view -Ov - > eg2.raw.bcf</code></pre> <p>Then to view the variants, run:</p> <pre><code>bcftools view eg2.raw.bcf</code></pre> -<p>See the official SAMtools guide to <a href="http://samtools.sourceforge.net/mpileup.shtml">Calling SNPs/INDELs with SAMtools/BCFtools</a> for more details and variations on this process.</p> +<p>See the official SAMtools guide to <a +href="http://samtools.sourceforge.net/mpileup.shtml">Calling SNPs/INDELs +with SAMtools/BCFtools</a> for more details and variations on this +process.</p> <!-- fasta-continuous option does not exist but was added to prevent warnings due to the case insensitive nature of markdown URLs --> </body> |