Load /tmp/.../ncbi-tools6-6.1.20060301 into

branches/upstream/current.

7 files changed, 527 insertions, 51 deletions

diff --git a/network/id2arch/id2.asn b/network/id2arch/id2.asn
index 00c6c411..b367e57b 100644
--- a/network/id2arch/id2.asn
+++ b/network/id2arch/id2.asn
@@ -1,4 +1,4 @@
---$Revision: 1.17 $
+--$Revision: 1.18 $
 --********************************************************************
 --
 --  Network Id server network access
@@ -316,7 +316,10 @@ ID2-Reply-Get-Blob-Id ::= SEQUENCE {
         annot-info      SEQUENCE OF ID2S-Seq-annot-Info OPTIONAL,
 
         -- this Blob-id is the last one in the request
-        end-of-reply    NULL OPTIONAL
+        end-of-reply    NULL OPTIONAL,
+
+        -- state of the blob
+        blob-state      ID2-Blob-State OPTIONAL
 }
 
 
diff --git a/network/wwwblast/Src/Makefile.wblast2_cs b/network/wwwblast/Src/Makefile.wblast2_cs
new file mode 100644
index 00000000..2f0571d4
--- /dev/null
+++ b/network/wwwblast/Src/Makefile.wblast2_cs
@@ -0,0 +1,50 @@
+#This is makefile for web blast2 that uses c++ showalign API
+builddir = $(NCBI)/c++.metastable/DebugMT/build
+builddir = $(NCBI)/c++.metastable/ReleaseMT/build
+
+###  DEFAULT COMPILATION FLAGS  -- DON'T EDIT OR MOVE THESE 4 LINES !!!  ###
+include $(builddir)/Makefile.mk
+
+
+LOCAL_CPPFLAGS += -I. -I/netopt/ncbi_tools/include -I../../../../internal/blast/SplitDB -DNCBI_ENTREZ_CLIENT -DNCBI_CLIENT_SERVER -DNCBI_INTERNAL_NEW_FORMATTER
+
+srcdir = .
+BINCOPY = @:
+
+
+APP = wblast2_cs.REAL
+
+SRC = wblast2 showalignwrap
+
+LIB = xblastformat xblast xnetblast scoremat xalntool xalnmgr blastxml xobjread ncbi_xloader_blastdb xobjutil $(OBJMGR_LIBS:=-static) xhtml xcgi seqdb  blastdb 
+
+
+
+CPPFLAGS = $(ORIG_CPPFLAGS) $(NCBI_C_INCLUDE)
+
+LIB += $(SD_DBAPI)
+
+
+LIBS =  $(NCBI_C_LIBPATH) \
+        -lbob -lsplitdbasn\
+        -lncbitxc2 -lnetblast -lncbiid1 -lncbidesk -lblastapi -lncbitool -lblastcompadj \
+        -lnetentr -lncbiNacc -lnetentr -lnetcli \
+        -lvibgif -lncbidesk -lncbi -lvibrant -lncbicdr -lncbiobj -lncbi \
+        $(NCBI_OTHERLIBS) $(CMPRS_LIBS) $(NETWORK_PURE_LIBS) $(ORIG_LIBS) \
+        -lresolv -lconnext -lxncbi -ldl -lblast
+
+CFLAGS   = $(ORIG_CFLAGS) 
+CXXFLAGS = $(ORIG_CXXFLAGS)
+LDFLAGS  = $(ORIG_LDFLAGS) \
+         -L../../../../internal/blast/SplitDB/lib
+
+#                                                                         ###
+#############################################################################
+
+
+###  APPLICATION BUILD RULES  -- DON'T EDIT OR MOVE THIS LINE !!!  ###
+
+include $(builddir)/Makefile.app
+MAKEFILE = Makefile.light_getreq_app
+
+###  PUT YOUR OWN ADDITIONAL TARGETS (MAKE COMMANDS/RULES) BELOW HERE  ###
\ No newline at end of file
diff --git a/network/wwwblast/Src/showalignwrap.cpp b/network/wwwblast/Src/showalignwrap.cpp
new file mode 100644
index 00000000..e9ab1c87
--- /dev/null
+++ b/network/wwwblast/Src/showalignwrap.cpp
@@ -0,0 +1,204 @@
+/*  $Id: showalignwrap.cpp,v 1.1 2006/01/05 17:28:57 jianye Exp $
+ * ===========================================================================
+ *
+ *                            PUBLIC DOMAIN NOTICE
+ *               National Center for Biotechnology Information
+ *
+ *  This software/database is a "United States Government Work" under the
+ *  terms of the United States Copyright Act.  It was written as part of
+ *  the author's official duties as a United States Government employee and
+ *  thus cannot be copyrighted.  This software/database is freely available
+ *  to the public for use. The National Library of Medicine and the U.S.
+ *  Government have not placed any restriction on its use or reproduction.
+ *
+ *  Although all reasonable efforts have been taken to ensure the accuracy
+ *  and reliability of the software and data, the NLM and the U.S.
+ *  Government do not and cannot warrant the performance or results that
+ *  may be obtained by using this software or data. The NLM and the U.S.
+ *  Government disclaim all warranties, express or implied, including
+ *  warranties of performance, merchantability or fitness for any particular
+ *  purpose.
+ *
+ *  Please cite the author in any work or product based on this material.
+ *
+ * ===========================================================================
+ *
+ * Author:  Jian Ye
+ *
+ * File Description:
+ *   c adaptor to showalign.cpp
+ *
+ */
+
+
+#include <corelib/ncbiapp.hpp>
+#include <corelib/ncbiargs.hpp>
+#include <corelib/ncbienv.hpp>
+#include <corelib/ncbistre.hpp>
+#include <serial/iterator.hpp>
+#include <serial/objistr.hpp>
+#include <serial/objostr.hpp>
+#include <serial/serial.hpp>
+#include <objtools/blast_format/showalign.hpp>
+#include <showalignwrap.h>
+#include <ctools/asn_converter.hpp>
+#include <objtools/data_loaders/blastdb/bdbloader.hpp>
+#include <objmgr/object_manager.hpp>
+#include <objmgr/gbloader.hpp>
+#include <algo/blast/api/blast_aux.hpp>
+
+
+
+USING_SCOPE(ncbi);
+USING_SCOPE(objects);
+
+
+static void  
+s_BlastFormat_ConvertToCppLoc(list <CRef<blast::CSeqLocInfo> >& target_mask,
+                              ValNodePtr source_mask)
+{
+    DECLARE_ASN_CONVERTER(CSeq_loc, SeqLoc, convertor_feat); 
+    ValNodePtr  mask_temp = source_mask;
+    while(mask_temp){
+        int frame(0);
+        switch(mask_temp->choice) {
+        case Blast_mask_frame_minus1: frame = -1; break;
+        case Blast_mask_frame_minus2: frame = -2; break;
+        case Blast_mask_frame_minus3: frame = -3; break;
+        case Blast_mask_frame_plus1:  frame =  1; break;
+        case Blast_mask_frame_plus2:  frame =  2; break;
+        case Blast_mask_frame_plus3:  frame =  3; break;
+        default:                      frame =  0; break;
+        }
+      
+
+        SeqLocPtr slp = (SeqLocPtr) mask_temp->data.ptrvalue;
+        
+        if (slp->choice == SEQLOC_PACKED_INT){
+            for (ValNodePtr vnpTemp2 = (ValNodePtr) slp->data.ptrvalue;  vnpTemp2; vnpTemp2 = vnpTemp2->next){
+                CRef<CSeq_loc> seqloc(new CSeq_loc());
+                convertor_feat.FromC((SeqLocPtr)vnpTemp2, &*seqloc); 
+                CSeq_interval* interval = &seqloc->SetInt();
+                CRef<blast::CSeqLocInfo> seqlocinfo
+                    (new blast::CSeqLocInfo(interval, frame));
+                
+                target_mask.push_back(seqlocinfo);
+            }
+        } else if (slp->choice == SEQLOC_INT) {
+            CRef<CSeq_loc> seqloc(new CSeq_loc());
+            convertor_feat.FromC(slp, &*seqloc); 
+            CRef<blast::CSeqLocInfo> seqlocinfo
+                (new blast::CSeqLocInfo(&seqloc->SetInt(), frame)); 
+            target_mask.push_back(seqlocinfo);
+        }
+        mask_temp=mask_temp->next;
+        
+    }
+} 
+
+void DisplayAlign(SeqAlignPtr align, Int4 line_len, BioseqPtr query,
+                  BioseqPtr subject, CharPtr program, Int4Ptr PNTR matrix,
+                  ValNodePtr mask, Int4 mask_char, Int4 mask_color,
+                  Boolean cds_translation, Int4 view, FILE *fp)
+{
+   
+    CSeq_align_set seqalignSet;
+    DECLARE_ASN_CONVERTER(CSeq_align, SeqAlign, convertor_seqalign);
+    
+    for (SeqAlignPtr salpTemp = align; salpTemp; salpTemp = salpTemp->next){
+        CRef<CSeq_align> csal(new CSeq_align());
+        convertor_seqalign.FromC(salpTemp, &*csal);
+        seqalignSet.Set().push_back(csal);
+    }
+    
+    CRef<CObjectManager> obj;
+    obj = CObjectManager::GetInstance();
+    CGBDataLoader::RegisterInObjectManager(*obj);       
+    CRef<CScope> scope (new CScope(*obj));
+    scope->AddDefaults();
+    
+  
+    DECLARE_ASN_CONVERTER(CBioseq, Bioseq, convertor2);  
+  
+    CRef<CBioseq> cbsp(new CBioseq());
+    convertor2.FromC(subject, &*cbsp); 
+    CRef<CSeq_entry> entry(new CSeq_entry());
+    entry->SetSeq(*cbsp);
+    scope->AddTopLevelSeqEntry(*entry);
+    
+    DECLARE_ASN_CONVERTER(CBioseq, Bioseq, convertor3); 
+    CRef<CBioseq> cbsp2(new CBioseq());
+    convertor3.FromC(query, &*cbsp2); 
+    CRef<CSeq_entry> entry2(new CSeq_entry());
+    entry2->SetSeq(*cbsp2);
+    scope->AddTopLevelSeqEntry(*entry2);
+    //auto_ptr<CObjectOStream> out2(CObjectOStream::Open(eSerial_AsnText, cout));
+    //*out2 << seqalignSet;
+    int option = 0;
+
+    list <CRef<blast::CSeqLocInfo> > mask_loc;
+
+    s_BlastFormat_ConvertToCppLoc(mask_loc, mask);
+  
+    int the_matrix[CDisplaySeqalign::ePMatrixSize][CDisplaySeqalign::ePMatrixSize];
+    if(matrix){
+        for(int i = 0; i < CDisplaySeqalign::ePMatrixSize; i ++){
+            for(int j = 0; j < CDisplaySeqalign::ePMatrixSize; j ++){
+                the_matrix[i][j] = matrix[i][j];
+            }
+        }
+    }
+    CDisplaySeqalign cds(seqalignSet,  *scope, &mask_loc, NULL, 
+                         matrix ? the_matrix : NULL);
+    CNcbiOstrstream oss;
+    if(strcmp(program, "tblastx") == 0){
+        option += CDisplaySeqalign::eTranslateNucToNucAlignment;
+    }
+    option += CDisplaySeqalign::eShowBlastStyleId;
+    if (cds_translation) {
+        option += CDisplaySeqalign::eShowCdsFeature;
+    }
+    option += CDisplaySeqalign::eShowBlastInfo;
+    option += CDisplaySeqalign::eShowNoDeflineInfo;
+    option += CDisplaySeqalign::eHtml;
+    if (view == 2){
+        option += CDisplaySeqalign::eColorDifferentBases;
+        option += CDisplaySeqalign::eShowIdentity;
+    } else {
+        option += CDisplaySeqalign::eShowMiddleLine;
+    }
+    
+    if (mask_char == 2){
+        cds.SetSeqLocChar(CDisplaySeqalign::eLowerCase);
+    }
+    
+    if (mask_color == 2){
+        cds.SetSeqLocColor(CDisplaySeqalign::eGrey);
+    } else if (mask_color == 3){
+        cds.SetSeqLocColor(CDisplaySeqalign::eRed);
+    }
+    
+    if(strcmp(program, "blastn") == 0){//blastn
+        cds.SetMiddleLineStyle (CDisplaySeqalign::eBar);
+        cds.SetAlignType(CDisplaySeqalign::eNuc);
+    } else {
+        cds.SetMiddleLineStyle (CDisplaySeqalign::eChar);
+        cds.SetAlignType(CDisplaySeqalign::eProt);
+    }
+   
+    cds.SetAlignOption(option);
+    cds.DisplaySeqalign(oss);
+    string output = (string)(CNcbiOstrstreamToString(oss));
+    fprintf(fp, "%s", output.c_str());
+   
+}
+
+
+/* 
+*============================================================
+*$Log: showalignwrap.cpp,v $
+*Revision 1.1  2006/01/05 17:28:57  jianye
+*for wblast2 to use new formatter
+*
+
+*/
diff --git a/network/wwwblast/Src/showalignwrap.h b/network/wwwblast/Src/showalignwrap.h
new file mode 100644
index 00000000..fcd068d2
--- /dev/null
+++ b/network/wwwblast/Src/showalignwrap.h
@@ -0,0 +1,77 @@
+/*  $Id: showalignwrap.h,v 1.1 2006/01/05 17:28:57 jianye Exp $
+ * ===========================================================================
+ *
+ *                            PUBLIC DOMAIN NOTICE
+ *               National Center for Biotechnology Information
+ *
+ *  This software/database is a "United States Government Work" under the
+ *  terms of the United States Copyright Act.  It was written as part of
+ *  the author's official duties as a United States Government employee and
+ *  thus cannot be copyrighted.  This software/database is freely available
+ *  to the public for use. The National Library of Medicine and the U.S.
+ *  Government have not placed any restriction on its use or reproduction.
+ *
+ *  Although all reasonable efforts have been taken to ensure the accuracy
+ *  and reliability of the software and data, the NLM and the U.S.
+ *  Government do not and cannot warrant the performance or results that
+ *  may be obtained by using this software or data. The NLM and the U.S.
+ *  Government disclaim all warranties, express or implied, including
+ *  warranties of performance, merchantability or fitness for any particular
+ *  purpose.
+ *
+ *  Please cite the author in any work or product based on this material.
+ *
+ * ===========================================================================
+ *
+ * Author:  Jian Ye
+ *
+ * File Description:
+ *   c adaptor to showalign.hpp
+ *
+ */
+
+#ifndef SHOWALIGN_WRAP_H
+#define SHOWALIGN_WRAP_H
+
+#include <ncbi.h>
+#include <objseq.h>
+#include <objsset.h>
+#include <sequtil.h>
+#include <seqport.h>
+#include <tofasta.h>
+#include <blast.h>
+#include <blastpri.h>
+
+#include <gapxdrop.h>
+#include <salsap.h>
+#include <objalign.h>
+#include <accentr.h>
+#include <objblst3.h>
+
+
+
+#ifdef __cplusplus 
+extern "C" {
+#endif
+void DisplayAlign(SeqAlignPtr align, Int4 line_len, BioseqPtr query, 
+                  BioseqPtr subject, CharPtr program, 
+                  Int4Ptr PNTR matrix,
+                  ValNodePtr mask,  Int4 mask_char, Int4 mask_color,
+                  Boolean cds_translation, Int4 view, FILE *fp);
+
+
+#ifdef __cplusplus
+}
+#endif
+
+#endif
+
+
+/* 
+*============================================================
+*$Log: showalignwrap.h,v $
+*Revision 1.1  2006/01/05 17:28:57  jianye
+*for wblast2 to use new formatter
+*
+
+*/
diff --git a/network/wwwblast/Src/test/run.pl b/network/wwwblast/Src/test/run.pl
index 052f7379..99e488b5 100755
--- a/network/wwwblast/Src/test/run.pl
+++ b/network/wwwblast/Src/test/run.pl
@@ -59,6 +59,8 @@ if ($app eq "wblast2.REAL" or $app eq "wblast2_cs.REAL") {
    $Tests{'short-subject-discmb'} = "\"PROGRAM=blastn&ONE=AE003820&SSEQ=aggacctcatcagcctcaaa&WORD=11&EXPECT=10000&MEGABLAST=yes\"";
    $Tests{'short-subject-blastn'} = "\"PROGRAM=blastn&ONE=AE003820&SSEQ=aggacctcatcagcctcaaa&WORD=11&EXPECT=10000\"";
    $Tests{'bare-fasta'} = "\"PROGRAM=blastn&SEQ=agcctggtaggctgcagtccatggggtcacacagagtcggacatgactgagcgacttcac&SSEQ=agcctggtaggctgcaatccatggggtcgctagagtcggacacgactgagcgacttcac&PROGRAM=blastn&FILTER=1\"";
+   $Tests{'cds_feature_plus'} = "\"ONE=48869482&TWO=60844&FROM=&TO=&FFROM=&TTO=&STRAND=1&FILTER=1&PROGRAM=blastn&cds_translation=on\"";
+   $Tests{'maks_color'} = "\"page=2&match=1&msmatch=-2&gopen=5&gext=2&dropoff=50&expect=10.000000&word=11&Filter=1&view=1&mask_char=2&mask_color=3&cds_translation=on&program=blastn&matrix=0&seq=u93236+&sseq=u93237&from=1&to=2772&ffrom=1&tto=9180\"";
 } else {
   if ($app eq "blast_cs.REAL") {
 
diff --git a/network/wwwblast/Src/viewgif.c b/network/wwwblast/Src/viewgif.c
index 5319b6c3..8a885ada 100644
--- a/network/wwwblast/Src/viewgif.c
+++ b/network/wwwblast/Src/viewgif.c
@@ -1,13 +1,58 @@
+/* $Id: viewgif.c,v 1.7 2005/12/28 20:56:14 merezhuk Exp $
+* ===========================================================================
+*
+*                            PUBLIC DOMAIN NOTICE
+*               National Center for Biotechnology Information
+*
+*  This software/database is a "United States Government Work" under the
+*  terms of the United States Copyright Act.  It was written as part of
+*  the author's official duties as a United States Government employee and
+*  thus cannot be copyrighted.  This software/database is freely available
+*  to the public for use. The National Library of Medicine and the U.S.
+*  Government have not placed any restriction on its use or reproduction.
+*
+*  Although all reasonable efforts have been taken to ensure the accuracy
+*  and reliability of the software and data, the NLM and the U.S.
+*  Government do not and cannot warrant the performance or results that
+*  may be obtained by using this software or data. The NLM and the U.S.
+*  Government disclaim all warranties, express or implied, including
+*  warranties of performance, merchantability or fitness for any particular
+*  purpose.
+*
+*  Please cite the author in any work or product based on this material.
+*
+* ===========================================================================
+*
+* File Name:  $RCSfile: viewgif.c,v $
+*
+* Author:  Ilya Dondoshansky
+*
+* Initial Creation Date: 2002/12/02
+*
+* $Revision: 1.7 $
+*
+* File Description:
+*        CGI program, part of standalone WWW Blast package, pipes graphic overview image back to user.
+*
+* $Log: viewgif.c,v $
+* Revision 1.7  2005/12/28 20:56:14  merezhuk
+* fix for broken gif;
+*
+*
+*/
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
 #include <signal.h>
 #include <fcntl.h>
-#include <stdio.h>
+
 
 static void SigAlrmHandler(int);
 static void SigTermHandler(int);
 
 static char FileName[128];
 
-main(void) 
+int main(void) 
 {
     FILE *pp;
     char tmp_buff[1024];
diff --git a/network/wwwblast/Src/wblast2.c b/network/wwwblast/Src/wblast2.c
index 9db717d0..298b6534 100644
--- a/network/wwwblast/Src/wblast2.c
+++ b/network/wwwblast/Src/wblast2.c
@@ -1,4 +1,4 @@
-/* $Id: wblast2.c,v 1.30 2005/12/05 16:14:48 coulouri Exp $
+/* $Id: wblast2.c,v 1.32 2006/01/17 21:47:28 madden Exp $
 * ===========================================================================
 *
 *                            PUBLIC DOMAIN NOTICE
@@ -27,12 +27,18 @@
 *
 * Initial Creation Date: 10/23/2000
 *
-* $Revision: 1.30 $
+* $Revision: 1.32 $
 *
 * File Description:
 *        BLAST 2 Sequences CGI program
 *
 * $Log: wblast2.c,v $
+* Revision 1.32  2006/01/17 21:47:28  madden
+* Adjust to change in BLAST_TwoSeqLocSets prototype
+*
+* Revision 1.31  2006/01/05 17:28:07  jianye
+* use new formatter for internal use
+*
 * Revision 1.30  2005/12/05 16:14:48  coulouri
 * c99 variable declaration breaks irix and solaris compilers
 *
@@ -254,7 +260,9 @@
 #include <poll.h>
 #endif
 #include <time.h>
-
+#ifdef NCBI_INTERNAL_NEW_FORMATTER
+#include <showalignwrap.h>
+#endif
 #include <blastpat.h>
 #ifndef BL2SEQ_STANDALONE
 #include <Liburlapi/qblastnet.h>
@@ -744,7 +752,25 @@ static void	Blast2SeqMainPage(CharPtr warning, CharPtr seq1, CharPtr seq2, CharP
             printf("<option value=3 SELECTED> Both strands\n");
             printf("<option value=1> Forward strand\n");
             printf("<option value=2> Reverse strand\n");
-            printf("</select><HR>\n");
+            printf("</select>&nbsp;&nbsp;&nbsp;");
+#ifdef NCBI_INTERNAL_NEW_FORMATTER
+            printf("View option <select name=\"view\">\n");
+            printf("<option value=1 SELECTED> Standard\n");
+            printf("<option value=2> Mismatch-highlighting\n");
+            printf("</select>&nbsp;&nbsp;&nbsp;\n");
+            printf("<BR>Masking character option <select name=\"mask_char\">\n");
+            printf("<option value=1 SELECTED> X for protein, n for nucleotide\n");
+            printf("<option value=2> Lower case\n");
+            printf("</select>&nbsp;&nbsp;&nbsp;\n");
+
+            printf("Masking color option <select name=\"mask_color\">\n");
+            printf("<option value=1 SELECTED> Black\n");
+            printf("<option value=2> Grey\n");
+            printf("<option value=3> Red\n");
+            printf("</select>&nbsp;&nbsp;&nbsp;\n");
+            printf("<BR><INPUT type=checkbox NAME=cds_translation>Show CDS translation\n"); 
+#endif       
+            printf("<HR>\n");
 
             printf("Open gap\n");
             printf("<INPUT type=text size=4 name=\"gopen\" value=5>\n");
@@ -1523,7 +1549,7 @@ static void BLASTOptionValidateHTML(BLAST_OptionsBlkPtr options, CharPtr prognam
 {
     Int2 status;
     ValNodePtr error_return=NULL;
-    
+
     status = BLASTOptionValidateEx(options, progname, &error_return);
     if (status != 0) {
         Blast2SeqMainPage(NULL, seq1, seq2, one, two, error_return, is_prot, options, mtrx, from, to, ffrom, tto, filter, pagecount);
@@ -1531,13 +1557,13 @@ static void BLASTOptionValidateHTML(BLAST_OptionsBlkPtr options, CharPtr prognam
     return;
 }
 
-static void PrintParam(Boolean is_prot, Int2 mtrx, Int2 ma, Int2 ms, BLAST_OptionsBlkPtr options, CharPtr seq_2, CharPtr seq_1, CharPtr one, CharPtr two, BioseqPtr query_bsp, BioseqPtr subject_bsp, Int4 len1, Int4 len2, Int4 from, Int4 to, Int4 ffrom, Int4 tto, Int2 pagecount)
+static void PrintParam(Boolean is_prot, Int2 mtrx, Int2 ma, Int2 ms, BLAST_OptionsBlkPtr options, CharPtr seq_2, CharPtr seq_1, CharPtr one, CharPtr two, BioseqPtr query_bsp, BioseqPtr subject_bsp, Int4 len1, Int4 len2, Int4 from, Int4 to, Int4 ffrom, Int4 tto, Int2 pagecount, Int4 view, Int4 mask_char, Int4 mask_color, Boolean cds_translation)
 {
     ValNodePtr vnp;
     CharPtr s;
     static Char buf[41];
     Int4 gi;
-
+    CharPtr defline = NULL;
     printf("<FORM NAME= bl2 method=\"POST\" action="    
 #if defined (BL2SEQ_STANDALONE) && defined (NCBI_ENTREZ_CLIENT)
            "\"wblast2_cs.cgi"
@@ -1583,6 +1609,27 @@ static void PrintParam(Boolean is_prot, Int2 mtrx, Int2 ma, Int2 ms, BLAST_Optio
     } else {
         printf(">\n");
     }
+#ifdef NCBI_INTERNAL_NEW_FORMATTER
+    printf("View option <select name=\"view\">\n");
+    printf("<option value=1 %s> Standard\n", view == 1 ? "SELECTED" : "");
+    printf("<option value=2 %s> Mismatch-highlighting\n", view == 2 ? "SELECTED" : "");
+    printf("</select>&nbsp;&nbsp;&nbsp;\n");
+    printf("<BR>Masking character option <select name=\"mask_char\">\n");
+    printf("<option value=1 %s> X for protein, n for nucleotide\n", mask_char == 1 ? "SELECTED" : "" );
+    printf("<option value=2 %s> Lower case\n", mask_char == 2 ? "SELECTED" : "");
+    printf("</select>&nbsp;&nbsp;&nbsp;\n");
+    
+    printf("Masking color option <select name=\"mask_color\">\n");
+    printf("<option value=1 %s> Black\n", mask_color == 1 ? "SELECTED" : "");
+    printf("<option value=2 %s> Grey\n", mask_color == 2 ? "SELECTED" : "");
+    printf("<option value=3 %s> Red\n", mask_color == 3 ? "SELECTED" : "");
+    printf("</select>&nbsp;&nbsp;&nbsp;\n");
+    printf("<BR><INPUT type=checkbox NAME=cds_translation"); 
+    if (cds_translation) {
+        printf(" CHECKED");
+    }
+    printf(">Show CDS translation\n");
+#endif
     printf("<INPUT TYPE=hidden name=\"program\" value=\"%s\">\n",
            options->program_name);
     
@@ -1619,50 +1666,49 @@ static void PrintParam(Boolean is_prot, Int2 mtrx, Int2 ma, Int2 ms, BLAST_Optio
     printf("<INPUT TYPE=hidden name=\"to\" value=\"%d\">\n", to);
     printf("<INPUT TYPE=hidden name=\"ffrom\" value=\"%d\">\n", ffrom);
     printf("<INPUT TYPE=hidden name=\"tto\" value=\"%d\">\n", tto);
-    printf("<TABLE>\n");
-    printf("<TR><TD><strong> Sequence 1</strong></TD>\n");
+
+    printf("<BR><strong> Sequence 1</strong>: ");
     if ((gi = GetGIForSeqId(SeqIdFindBest(query_bsp->id, SEQID_GI))) != 0) {
-        printf("<TD>gi<A HREF=http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=%ld> %ld</A></TD>", gi, gi);
+        SeqIdWrite(query_bsp->id, buf, PRINTID_FASTA_SHORT, 30);
+        printf("<A HREF=http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=%ld>gi|%ld|%s</A>", gi, gi, buf);
     } else {
         SeqIdWrite(query_bsp->id, buf, PRINTID_FASTA_LONG, 40);
-        printf("<TD>%s</TD>", buf);
+        printf("%s", buf);
     }
-    for (vnp=query_bsp->descr; vnp; vnp=vnp->next) {
-        if (vnp->choice == Seq_descr_title) {
-            printf("<TD>%s</TD>", vnp->data.ptrvalue);
-            break;
-        }
-    }
-    if (vnp == NULL) {
-        printf("<TD></TD>");
-    }
-    printf("<TD><strong>Length</strong></TD><TD>%ld</TD>\n", len1);
+ 
+    defline = BioseqGetTitle(query_bsp);
+    if(defline) {
+        printf("%s", defline);
+    } 
+
+    printf("<BR>");
+    
+    printf("Length = %ld\n", len1);
     if (from != 0 || to != 0) {
-        printf("<TD>(%ld .. %ld)</TD>\n", from, to);
+        printf("(%ld .. %ld)\n", from, to);
     }
-    printf("</TR><TR>\n");
-    printf("<TR><TD><strong> Sequence 2</strong></TD>\n");
+    printf("<BR><BR>\n");
+    printf("<strong> Sequence 2</strong>: ");
     if ((gi = GetGIForSeqId(SeqIdFindBest(subject_bsp->id, SEQID_GI))) != 0) {
-        printf("<TD>gi <A HREF=http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=%ld>%ld</A></TD>", gi, gi);
+        SeqIdWrite(subject_bsp->id, buf, PRINTID_FASTA_SHORT, 30);
+        printf("<A HREF=http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=%ld>gi|%ld|%s</A>", gi, gi, buf);
     } else {
         SeqIdWrite(subject_bsp->id, buf, PRINTID_FASTA_LONG, 40);
-        printf("<TD>%s</TD>", buf);
+        printf("%s", buf);
     }
-    for (vnp=subject_bsp->descr; vnp; vnp=vnp->next) {
-        if (vnp->choice == Seq_descr_title) {
-            printf("<TD>%s</TD>", vnp->data.ptrvalue);
-            break;
-        }
-    }
-    if (vnp == NULL) {
-        printf("<TD></TD>");
-    }
-    printf("<TD><strong>Length</strong></TD><TD>%ld</TD>\n", len2);
+   
+    defline = BioseqGetTitle(subject_bsp);
+    if(defline) {
+        printf("%s", defline);
+    } 
+    printf("<BR>\n");
+
+    printf("Length = %ld\n", len2);
     if (ffrom != 0 || tto != 0) {
-        printf("<TD>(%ld .. %ld)</TD>\n", ffrom, tto);
+        printf("(%ld .. %ld)\n", ffrom, tto);
     }
-    printf("</TR></TABLE>\n");
-
+    printf("<BR><BR><BR>\n");
+   
     return;
 }
 
@@ -1971,6 +2017,7 @@ Int2 Main(void)
     Int2 mtrx = 0, color=1;
     SeqAlignPtr seqalign = NULL, sap, sapnext;
     SeqAnnotPtr hsat= NULL, sat, satnext;
+    SBlastSeqalignArray* seqalign_arr=NULL;
     FloatHi	expect;
     Boolean is_prot=FALSE, is_aa1=FALSE, is_aa2=FALSE, is_na1=TRUE, is_na2=TRUE;
     CharPtr seq_1=NULL, seq_2=NULL, chptr;
@@ -2015,6 +2062,9 @@ Int2 Main(void)
     CharPtr rid = NULL, database = NULL;
     sigset_t sigset;
     struct sigaction sa;
+    Int4 mask_color =1, mask_char = 1, view = 1;
+    Boolean cds_translation = FALSE;
+    CharPtr value_holder = NULL;
 #ifndef BL2SEQ_STANDALONE
     TNlmThread connection_thread = NULL;
     void *thrstat;
@@ -2086,6 +2136,23 @@ Int2 Main(void)
         fprintf(fd, "%s", ((WWWInfoDataPtr)theInfo->info)->query);
         FileClose(fd);
     }
+   
+    value_holder = WWWGetValueByName(theInfo->info, "mask_color");
+    if(value_holder) {
+        mask_color = atoi (value_holder);
+    }
+    value_holder = WWWGetValueByName(theInfo->info, "mask_char");
+    if(value_holder) {
+        mask_char = atoi (value_holder);
+    }
+    value_holder = WWWGetValueByName(theInfo->info, "view");
+    if(value_holder) {
+        view = atoi (value_holder);
+    }
+
+    if (WWWGetValueByName(theInfo->info, "cds_translation") != NULL) {
+        cds_translation = TRUE;
+    }
     
     if((chptr = WWWGetValueByName(theInfo->info, "PROGRAM")) != NULL)
         theInfo->program = StringSave(chptr);
@@ -2447,13 +2514,24 @@ Int2 Main(void)
 
     fake_bsp = BlastMakeFakeBioseq(query_bsp, NULL);
     if (from == 0 && to == 0) {
+#ifdef NCBI_INTERNAL_NEW_FORMATTER
+        ValNodeAddPointer(&slp1, SEQLOC_WHOLE, SeqIdDup(query_bsp->id));
+        len1 = query_bsp->length;
+#else
         ValNodeAddPointer(&slp1, SEQLOC_WHOLE, SeqIdDup(fake_bsp->id));
         len1 = fake_bsp->length;
+#endif
+        
     } else {
         sip1 = SeqIntNew();
         sip1->from = (from > 0) ? from-1 : 0; 
-        sip1->to = (to < fake_bsp->length) ? to-1 : fake_bsp->length-1;
+#ifdef NCBI_INTERNAL_NEW_FORMATTER
+        sip1->to = (to < query_bsp->length) ? to-1 : query_bsp->length-1;
+        sip1->id = (SeqIdPtr) SeqIdDup (query_bsp->id);
+#else
+        sip1->to = (to < fake_bsp->length) ? to-1 : query_bsp->length-1;
         sip1->id = (SeqIdPtr) SeqIdDup (fake_bsp->id);
+#endif
         sip1->strand = options->strand_option;
         ValNodeAddPointer(&slp1, SEQLOC_INT, sip1);
         len1 = SeqLocLen(slp1);
@@ -2510,16 +2588,23 @@ Int2 Main(void)
 #ifndef USE_OLD_BLAST
     BLAST_SummaryOptionsInit(&s_options);
     BLASTOptions2SummaryOptions(options, progname, s_options);
-    BLAST_TwoSeqLocSets(s_options, slp1, slp2, NULL, &seqalign, &mask, &mask_at_hash,
+    BLAST_TwoSeqLocSets(s_options, slp1, slp2, NULL, &seqalign_arr, &mask, &mask_at_hash,
                         &s_return);
+    if (seqalign_arr && seqalign_arr->array)
+    {
+        seqalign = seqalign_arr->array[0];
+        seqalign_arr->array[0] = NULL;
+        seqalign_arr = SBlastSeqalignArrayFree(seqalign_arr);
+    }
+
     if (s_return->error) {

         /* Print the error message. */        

         Blast2SeqMainPage(s_return->error->message, seq1EntryData, seq2EntryData, NULL, NULL, NULL,

                           is_prot, options, mtrx, from, to, ffrom, tto, filter, 

                           pagecount);    

     } 

-

 
+  
     if (mask_at_hash) {
        /* If masking was done for lookup table only, do not use mask locations
           for formatting. */
@@ -2553,7 +2638,7 @@ Int2 Main(void)
                            len1, len2, progname);
         
         PrintParam(is_prot, mtrx, ma, ms, options, seq2EntryData, seq1EntryData, NULL, NULL,
-                   query_bsp, subject_bsp, len1, len2, from, to, ffrom, tto, pagecount);
+                   query_bsp, subject_bsp, len1, len2, from, to, ffrom, tto, pagecount, view, mask_char, mask_color, cds_translation);
         printf("<strong><font color=#0000EE>No significant similarity was found</font></strong>\n");
 
         goto cleanup;
@@ -2597,7 +2682,7 @@ Int2 Main(void)
     ValNodeFree(other_returns);
 #endif
     
-    to = (to >0) ? to : fake_bsp->length;
+    to = (to >0) ? to : query_bsp->length;
     tto = (tto >0) ? tto : subject_bsp->length;
     from = (from >0) ? from : 1;
     ffrom = (ffrom >0) ? ffrom : 1;
@@ -2606,7 +2691,7 @@ Int2 Main(void)
                        from, to, ffrom, tto, len1, len2, progname);
     
     PrintParam(is_prot, mtrx, ma, ms, options, seq2EntryData, seq1EntryData, NULL, NULL,
-               query_bsp, subject_bsp, len1, len2, from, to, ffrom, tto, pagecount);
+               query_bsp, subject_bsp, len1, len2, from, to, ffrom, tto, pagecount, view, mask_char, mask_color, cds_translation);
     
     align_type = BlastGetProgramNumber(progname);
     
@@ -2881,7 +2966,10 @@ Int2 Main(void)
                 color = 2;
             }
             printf("<a name=%d>\n", index);
+
+#ifndef NCBI_INTERNAL_NEW_FORMATTER
             PrintOutScore(sap, is_prot, NULL, mask);
+#endif
             if (sap->segtype == SAS_DENDIAG) {
                 for (ddp = sap->segs, index1=0; ddp; ddp= ddp->next, index1++);
             } else if (sap->segtype == SAS_DENSEG) {
@@ -2918,9 +3006,16 @@ Int2 Main(void)
         txoption += TXALIGN_HTML;
         
         AddAlignInfoToSeqAnnot(sat, align_type); 
-        
+#ifdef NCBI_INTERNAL_NEW_FORMATTER
+        fprintf(stdout, "<pre>");
+        DisplayAlign((SeqAlignPtr)sat->data, 60, query_bsp, subject_bsp,
+                     progname, txmatrix, mask, mask_char, mask_color, 
+                     cds_translation, view, stdout);
+        fprintf(stdout, "</pre>");
+#else
         ShowTextAlignFromAnnot(sat, 60, stdout, NULL, NULL,
-                               txoption, txmatrix, mask, NULL);
+                               txoption, txmatrix, mask, NULL); 
+#endif
     }
 
 cleanup: