diff options
Diffstat (limited to 'doc/blast/fastacmd.html')
| -rw-r--r-- | doc/blast/fastacmd.html | 161 |
1 files changed, 161 insertions, 0 deletions
diff --git a/doc/blast/fastacmd.html b/doc/blast/fastacmd.html new file mode 100644 index 00000000..c99edd8e --- /dev/null +++ b/doc/blast/fastacmd.html @@ -0,0 +1,161 @@ +fastacmd README +=============== +Last updated: 04/09/2003 + + +Table of Contents + + Introduction + + Command line options + + Usage + + Return values + + Notes/Troubleshooting + + + +Introduction +------------ + +fastacmd retrives FASTA formatted sequences from a blast database, as long as +it it was successfully formatted using the '-o' option. + +Command line options +-------------------- +The fastacmd options are: + +fastacmd 2.2.5 arguments: + + -d Database [String] Optional + default = nr + -p Type of file + G - guess mode (look for protein, then nucleotide) + T - protein + F - nucleotide [String] Optional + default = G + -s Search string: GIs, accessions and locuses may be used delimited + by comma. [String] Optional + -i Input file wilth GIs/accessions/locuses for batch + retrieval [String] Optional + -a Retrieve duplicate accessions [T/F] Optional + default = F + -l Line length for sequence [Integer] Optional + default = 80 + -t Definition line should contain target gi only [T/F] Optional + default = F + + This option is only relevant to non-redundant databases only (ie: + protein nr and pataa, as provided in the NCBI ftp site) + + -o Output file [File Out] Optional + default = stdout + -c Use Ctrl-A's as non-redundant defline separator [T/F] Optional + default = F + -D Dump the entire database in fasta format [T/F] Optional + default = F + -L Range of sequence to extract (Format: start,stop) + 0 in 'start' refers to the beginning of the sequence + 0 in 'stop' refers to the end of the sequence [String] Optional + default = 0,0 + -S Strand on subsequence (nucleotide only): 1 is top, 2 is bottom [Integer] + default = 1 + -T Print taxonomic information for requested sequence(s) [T/F] + default = F + -I Print database information only (overrides all other options) [T/F] + default = F + +Usage +----- + +1.) Retrieving a sequence by gi: + +fastacmd -d nt -s 555 +>gi|555|emb|X65215.1|BTMISATN B.taurus microsatellite DNA (624bp) +ACCTCCACTAGCTTTGTTTGTAGTGATGCTCTGTAGCACCACTGGGAAGCCCTTTAATGAATGTGCCTTTCCGCAAATCA +CACACACACAAATACACTTATAGAAACAAGGTGATTTTCTTGAAATAATAAAACAAAATTTGGAAGAAGATTTTTACTGT +CTTAGGAAAAGTAAGGCATTGGAAGGTGGCTAGGTATGACATATGAAGTTGCATTTTAAAACTGGAATTGGACAACTGAT +ATTCAGTGATATTTATGCTACTACCTTCTAGAATCGAGAGCATGCACCCCACTCTGTACTCTTGCCTGGAGAATCCATGA +TGAGAGCCTGGTAGGCTGCAGTCCATGGGGTCACACAGAGTCGGACATGACTGAGCGACTTCACTTTCACTTTTCAATTT +CATGCATTGGAGCCGGAAATGGCAACCCACTCCAGTGTTCTTGCCTGGAGAATCCCAGGGATGGGGAAGCCTGGTGGGCT +GCTGTCTATGGGGTCGCAGAGAGTCAGACACGACTGAAGTGACTTAGCAGCAACCTTCTGGAATAAACGCCTCAGGCTTT +AAACTCTGGCTTGACCATTCACTAGCCATGGGATCCACTAGAGTCGACCTGCAGGCATGCAAGC + +2.) Printing a summary of database statistics: + +fastacmd -d nt -I +Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, +1 or 2 HTGS sequences) + 1,711,089 sequences; 7,976,531,563 total letters + +File name: +/usr/ncbi/db/blast/nt + Date: Mar 26, 2003 10:25 PM Version: 4 Longest sequence: 1,421,559 bp + + +3.) Obtaining a FASTA file from a blast database: + +fastacmd -D -d nt -o nt.fsa +[output removed for brevity] + +4.) Retrieving only part of a sequence: + +fastacmd -d nt -s 555 -L0,32 +gi|555:1-32 B.taurus microsatellite DNA (624bp) +ACCTCCACTAGCTTTGTTTGTAGTGATGCTCT + +5.) Retrieving taxonomic information for a given sequence: + +fastacmd -d nt -s 555 -T +NCBI sequence id: gi|555|emb|X65215.1|BTMISATN +NCBI taxonomy id: 9913 +Common name: cow +Scientific name: Bos taurus + + +Return values +------------- +The following exit values are returned: + + 0 Completed successfully + + 1 An error occurred + + 2 Blast database was not found + + 3 Failed search (accession, gi, taxonomy info) + + 4 No taxonomy database was found + + +Notes/Troubleshooting +--------------------- + +A) Taxonomy information + +In order to access to the taxonomy information using fastacmd, the blast +databases should have been obtained from the NCBI ftp site +(ftp://ftp.ncbi.nih.gov/blast/db) and an additional set of +files are needed. These files are archived as taxdb.tar.gz under the same +directory as the blast databases on the NCBI ftp site. +Please install these files in the same directory as the blast databases (and +do not forget to update your ncbi configuration file to point to this +directory). +Here are some of the error messages one might encounter when accessing the +taxonomy information from the blast databases: + +fastacmd -d testdb -s 555 -T +[fastacmd] ERROR: Taxonomy information not encoded in your blast database. + +This blast database does not contain the taxonomy id encoded for this +gi/accession. Only preformatted blast databases provided by the NCBI contain +taxonomy identifiers encoded (formatdb cannot add this). + + +fastacmd -d patnt -s 412262 -T +[fastacmd] ERROR: Taxonomy information is not available. Please download it from +ftp://ftp.ncbi.nih.gov/blast/db/taxdb.tar.gz + +Download the required files and install them as described above. |