diff options
Diffstat (limited to 'doc')
| -rw-r--r-- | doc/blast.txt | 6 | ||||
| -rw-r--r-- | doc/dispatcher.html | 14 | ||||
| -rw-r--r-- | doc/firewall.html | 13 | ||||
| -rw-r--r-- | doc/formatdb.txt | 310 | ||||
| -rwxr-xr-x | doc/fwd_check.sh | 6 | ||||
| -rw-r--r-- | doc/images/seqn01.png | bin | 10031 -> 13063 bytes | |||
| -rw-r--r-- | doc/images/seqn02.png | bin | 7717 -> 9851 bytes | |||
| -rw-r--r-- | doc/images/seqn03.png | bin | 7199 -> 9119 bytes | |||
| -rw-r--r-- | doc/images/seqn04.png | bin | 6829 -> 8606 bytes | |||
| -rw-r--r-- | doc/images/seqn05.png | bin | 7825 -> 10839 bytes | |||
| -rw-r--r-- | doc/images/seqn06.png | bin | 9732 -> 12555 bytes | |||
| -rw-r--r-- | doc/images/seqn07.png | bin | 8135 -> 10265 bytes | |||
| -rw-r--r-- | doc/images/seqn08.png | bin | 10934 -> 14011 bytes | |||
| -rw-r--r-- | doc/images/seqn09.png | bin | 10542 -> 13953 bytes | |||
| -rw-r--r-- | doc/images/seqn10.png | bin | 9407 -> 11534 bytes | |||
| -rw-r--r-- | doc/images/seqn11.png | bin | 5126 -> 6515 bytes | |||
| -rw-r--r-- | doc/images/seqn12.png | bin | 5795 -> 7378 bytes | |||
| -rw-r--r-- | doc/images/seqn13.png | bin | 16823 -> 22177 bytes | |||
| -rw-r--r-- | doc/images/seqn14.png | bin | 9537 -> 9785 bytes | |||
| -rw-r--r-- | doc/images/seqn15.png | bin | 14204 -> 14420 bytes | |||
| -rw-r--r-- | doc/images/seqn16.png | bin | 13491 -> 15841 bytes | |||
| -rw-r--r-- | doc/images/seqn17.png | bin | 13426 -> 16992 bytes | |||
| -rw-r--r-- | doc/images/seqn18.png | bin | 10939 -> 13600 bytes | |||
| -rw-r--r-- | doc/images/seqn19.png | bin | 8801 -> 11534 bytes | |||
| -rw-r--r-- | doc/images/seqn20.png | bin | 9016 -> 11379 bytes | |||
| -rw-r--r-- | doc/images/seqn21.png | bin | 18009 -> 20889 bytes | |||
| -rw-r--r-- | doc/images/seqn22.png | bin | 5157 -> 6913 bytes | |||
| -rw-r--r-- | doc/man/asn2gb.1 | 14 | ||||
| -rw-r--r-- | doc/man/blast.1 | 5 | ||||
| -rw-r--r-- | doc/man/fastacmd.1 | 17 | ||||
| -rw-r--r-- | doc/man/tbl2asn.1 | 26 | ||||
| -rw-r--r-- | doc/sequin.htm | 48 |
32 files changed, 231 insertions, 228 deletions
diff --git a/doc/blast.txt b/doc/blast.txt index 44141b4f..944b2c49 100644 --- a/doc/blast.txt +++ b/doc/blast.txt @@ -1,18 +1,20 @@ README for stand-alone BLAST -$Date: 2003/06/30 16:30:18 $ +$Date: 2004/01/30 21:13:06 $ This document provides information on stand-alone BLAST. Topics covered are setting up stand-alone BLAST, command-line options for stand-alone BLAST, and a release history of the different versions. +NCBI provides binaries for the following platforms: + Apple MacOS 9 (powerpc) Apple MacOS X (powerpc) DEC/Compaq/HP OSF1 5.1 (alpha) FreeBSD 4.5 (ia32) HP HPUX 11 (hppa, ia64) IBM AIX 5.1 (power4, powerpc) -Linux (kernel 2.4, glibc 2.2.4) (ia32, ia64) +Linux (kernel 2.4, glibc 2.2.4) (ia32, ia64, amd64) Microsoft Windows 2000 (ia32) SGI IRIX 6.5 (mips) Sun Solaris 7 (ia32) diff --git a/doc/dispatcher.html b/doc/dispatcher.html index 64955714..a7c1832f 100644 --- a/doc/dispatcher.html +++ b/doc/dispatcher.html @@ -392,18 +392,6 @@ Firewall Port IP Address </pre> <p> -Please also note obsolescent settings that still should be provided -but will be removed in the nearest future: - -<p align="center"> -<pre> -Firewall Port IP Address --------------------------------- - 5811 130.14.22.32 - 5812 130.14.22.31 -</pre> - -<p> If your firewall is not transparent, the firewall port number should be mapped to the same port number on the external host. @@ -559,7 +547,7 @@ you have a question, please contact <a href="mailto:info@ncbi.nlm.nih.gov"> <p> <hr> <table border="0" cellspasing="0"> -<tr><td>Source: distrib/doc/dispatcher.html</td><td>$Date: 2003/09/29 15:04:00 $</td><td>$Revision: 6.23 $</td></tr> +<tr><td>Source: distrib/doc/dispatcher.html</td><td>$Date: 2004/01/16 19:03:44 $</td><td>$Revision: 6.24 $</td></tr> </table> diff --git a/doc/firewall.html b/doc/firewall.html index 763e656b..3733e603 100644 --- a/doc/firewall.html +++ b/doc/firewall.html @@ -48,7 +48,7 @@ <p> </p> <p> - <i>Last modified:</i> $Date: 2003/09/29 15:04:00 $<br> + <i>Last modified:</i> $Date: 2004/01/16 19:03:44 $<br> <i>Latest version: </i> <a href="http://www.ncbi.nlm.nih.gov/cpp/network/firewall.html"> http://www.ncbi.nlm.nih.gov/cpp/network/firewall.html</a> @@ -120,17 +120,6 @@ Firewall Port IP Address 5845 130.14.22.12 (cannot be accessed from outside NCBI!) </pre> -Please also note obsolescent settings that still should be provided -but will be removed in the nearest future: - -<p align="center"> -<pre> -Firewall Port IP Address --------------------------------- - 5811 130.14.22.32 - 5812 130.14.22.31 -</pre> - <p> If your firewall is not transparent, the firewall port number should be mapped to the same port number on the external host. diff --git a/doc/formatdb.txt b/doc/formatdb.txt index 1ef831f7..75beccdb 100644 --- a/doc/formatdb.txt +++ b/doc/formatdb.txt @@ -3,24 +3,24 @@ Formatdb README Table of Contents - Introduction + Introduction - Command Line Options + Command Line Options Configuration File - Formatdb Notes/Troubleshooting - - A The -o option and identifiers - B "SORTFiles failed" message - C Formatting large FASTA files - D Piping a database to formatdb without uncompressing - E Creating custom databases. - F General troubleshooting tips. - G "SeqIdParse Failure" error - H "FileOpen" error + Formatdb Notes/Troubleshooting + + A The -o option and identifiers + B "SORTFiles failed" message + C Formatting large FASTA files + D Piping a database to formatdb without uncompressing + E Creating custom databases. + F General troubleshooting tips. + G "SeqIdParse Failure" error + H "FileOpen" error - Appendix 1: The Files Produced by Formatdb + Appendix 1: The Files Produced by Formatdb @@ -46,143 +46,133 @@ Command Line Options A list of the command line options and the current version for formatdb may be obtained by executing formatdb without options, as in: - formatdb - + formatdb - The formatdb options are summarized below: formatdb 2.2.5 arguments: - -t Title for database file [String] - Optional - -i Input file(s) for formatting (this parameter must be set) - [File In] - -l Logfile name: [File Out] - Optional + -t Title for database file [String] + Optional + -i Input file(s) for formatting (this parameter must be set) + [File In] + -l Logfile name: [File Out] + Optional default = formatdb.log - -p Type of file - T - protein - F - nucleotide [T/F] Optional - default = T + -p Type of file + T - protein + F - nucleotide [T/F] Optional + default = T - -o Parse options - T - True: Parse SeqId and create indexes. - F - False: Do not parse SeqId. Do not create indexes. - [T/F] Optional default = F + -o Parse options + T - True: Parse SeqId and create indexes. + F - False: Do not parse SeqId. Do not create indexes. + [T/F] Optional default = F - If the "-o" option is TRUE (and the source database is in FASTA - format), then the database identifiers in the FASTA definition - line must follow the convention of the FASTA Defline Format. - Please see section "F Note on creating custom databases" - below. + If the "-o" option is TRUE (and the source database is in FASTA + format), then the database identifiers in the FASTA definition + line must follow the convention of the FASTA Defline Format. + Please see section "F Note on creating custom databases" + below. - -a Input file is database in ASN.1 format (otherwise FASTA is expected) - T - True, - F - False. - [T/F] Optional default = F + -a Input file is database in ASN.1 format (otherwise FASTA is expected) + T - True, + F - False. + [T/F] Optional default = F - -b ASN.1 database in binary mode - T - binary, - F - text mode. - [T/F] Optional default = F + -b ASN.1 database in binary mode + T - binary, + F - text mode. + [T/F] Optional default = F - A source ASN.1 database may be represented in two formats - - ascii text and binary. The "-b" option, if TRUE, specifies that - input ASN.1 database is in binary format. The option is ignored - in case of FASTA input database. + A source ASN.1 database may be represented in two formats - + ascii text and binary. The "-b" option, if TRUE, specifies that + input ASN.1 database is in binary format. The option is ignored + in case of FASTA input database. - -e Input is a Seq-entry [T/F] - Optional - default = F + -e Input is a Seq-entry [T/F] + Optional + default = F - A source ASN.1 database (either text ascii or binary) may - contain a Bioseq-set or just one Bioseq. In the latter case the - "-e" switch should be set to TRUE. + A source ASN.1 database (either text ascii or binary) may + contain a Bioseq-set or just one Bioseq. In the latter case the + "-e" switch should be set to TRUE. - -n Base name for BLAST files [String] - Optional + -n Base name for BLAST files [String] + Optional - This options allows one to produce BLAST databases with a - different name than that of the original FASTA file. For - instance, one could have a file named 'ecoli.nuc.txt' and and - format it as 'ecoli': + This options allows one to produce BLAST databases with a + different name than that of the original FASTA file. For + instance, one could have a file named 'ecoli.nuc.txt' and and + format it as 'ecoli': - formatdb -i ecoli.nuc.txt -p F -o T -n ecoli + formatdb -i ecoli.nuc.txt -p F -o T -n ecoli - uncompress -c nr.z | formatdb -i stdin -o T -n nr + uncompress -c nr.z | formatdb -i stdin -o T -n nr - This can be used in situations where the original FASTA file is - not required other than by formatdb. This can help in a - situation where disk-space is tight. + This can be used in situations where the original FASTA file is + not required other than by formatdb. This can help in a + situation where disk-space is tight. - -v Database volume size in millions of letters [Integer] Optional - default = 0 + -v Database volume size in millions of letters [Integer] Optional + default = 0 range from 0 to <NULL> - This option breaks up large FASTA files into 'volumes' (each - with a maximum size of 2 billion letters). As part of the - creation of a volume formatdb writes a new type of BLAST - database file, called an alias file, with the extension 'nal' - or 'pal'. + This option breaks up large FASTA files into 'volumes' (each + with a maximum size of 2 billion letters). As part of the + creation of a volume formatdb writes a new type of BLAST + database file, called an alias file, with the extension 'nal' + or 'pal'. - -s Create indexes limited only to accessions - sparse [T/F] - Optional - default = F + -s Create indexes limited only to accessions - sparse [T/F] + Optional + default = F - This option limits the indices for the string identifiers (used - by formatdb) to accessions (i.e., no locus names). This is - especially useful for sequences sets like the EST's where the - accession and locus names are identical. Formatdb runs faster - and produces smaller temporary files if this option is used. - It is strongly recommended for EST's, STS's, GSS's, and - HTGS's. + This option limits the indices for the string identifiers (used + by formatdb) to accessions (i.e., no locus names). This is + especially useful for sequences sets like the EST's where the + accession and locus names are identical. Formatdb runs faster + and produces smaller temporary files if this option is used. + It is strongly recommended for EST's, STS's, GSS's, and + HTGS's. - -A Create ASN.1 structured deflines [T/F] - Optional - default = T + -L Create an alias file with this name + use the gifile arg (below) if set to calculate db size + use the BLAST db specified with -i (above) [File Out] Optional - This option produces a new BLAST database format (version 4). - The BLAST programs can read this format as well as the current format. - The program automatically identifies which version it should work - with. This new format stores the sequence definition lines in - a structured manner (as ASN.1), this will allow future versions of - BLAST to better present taxonomic information as well as information - about other resources (e.g., UniGene, LocusLink) for a database sequence. + This option produces a BLAST database alias file using a specified + database, but limiting the sequences searched to those in the GI list + given by the -F argument. See the section "Note on creating an alias file + for a GI list" for more information. - -L Create an alias file with this name - use the gifile arg (below) if set to calculate db size - use the BLAST db specified with -i (above) [File Out] Optional + -F Gifile (file containing list of gi's) [File In] Optional - This option produces a BLAST database alias file using a specified - database, but limiting the sequences searched to those in the GI list - given by the -F argument. See the section "Note on creating an alias file - for a GI list" for more information. + This option can be used to specify the GI list for the alias file + construction (-L option above) or to produce a binary GI list if + the -B option (below) is set. - -F Gifile (file containing list of gi's) [File In] Optional + -B Binary Gifile produced from the Gifile specified above [File Out] Optional - This option can be used to specify the GI list for the alias file - construction (-L option above) or to produce a binary GI list if - the -B option (below) is set. - - -B Binary Gifile produced from the Gifile specified above [File Out] Optional - - This option specifies the name of a binary GI list file. This option should - be used with the -F option. A text GI list may be specified with the -F - option and the -B option will produce that GI list in binary format. The - binary file is smaller and BLAST does not need to convert it, so it can - be read faster. + This option specifies the name of a binary GI list file. This option should + be used with the -F option. A text GI list may be specified with the -F + option and the -B option will produce that GI list in binary format. The + binary file is smaller and BLAST does not need to convert it, so it can + be read faster. Configuration File ------------------ Starting from formatdb version 4, we have added a configuration file to allow flexibility in specifying the membership and link bits to set in the ASN.1 -defline structures. The membership bit arrays are used to help distinguish -sequences that belong to a subset database (e.g.: pdb, swissprot) in a -non-redundant database (e.g.: nr). The link bit arrays are used to indentify -which sequences should have a user specified "link out" in the blast (html) -report. These features are still under development and useful within NCBI -only. A sample configuration file follows: +defline structures. This feature is available by recompiling the formatdb +binary with the following compile time flag: -DSET_ASN1_DEFLINE_BITS. +The membership bit arrays are used to help distinguish sequences that belong +to a subset database (e.g.: pdb, swissprot) in a non-redundant database +(e.g.: nr). The link bit arrays are used to indentify which sequences should +have a user specified "link out" in the blast (html) report. These features +are still under development and useful within NCBI only. A sample +configuration file follows: ; .formatdbrc: formatdb configuration file ; @@ -465,6 +455,7 @@ contain at most about 4 billion bases. The new databases allows that to be much larger. +PLEASE NOTE THAT VERSION 3 OF THE BLAST DATABASES WILL NO LONGER BE SUPPORTED. The new databases keep the sequence descriptors in a structured format @@ -499,18 +490,18 @@ the identifiers for the databases from which the sequences were derived. Database Name Identifier Syntax - GenBank gb|accession|locus - EMBL Data Library emb|accession|locus - DDBJ, DNA Database of Japan dbj|accession|locus - NBRF PIR pir||entry - Protein Research Foundation prf||name - SWISS-PROT sp|accession|entry name - Brookhaven Protein Data Bank pdb|entry|chain - Patents pat|country|number - GenInfo Backbone Id bbs|number - General database identifier gnl|database|identifier - NCBI Reference Sequence ref|accession|locus - Local Sequence identifier lcl|identifier + GenBank gb|accession|locus + EMBL Data Library emb|accession|locus + DDBJ, DNA Database of Japan dbj|accession|locus + NBRF PIR pir||entry + Protein Research Foundation prf||name + SWISS-PROT sp|accession|entry name + Brookhaven Protein Data Bank pdb|entry|chain + Patents pat|country|number + GenInfo Backbone Id bbs|number + General database identifier gnl|database|identifier + NCBI Reference Sequence ref|accession|locus + Local Sequence identifier lcl|identifier For example, an identifier might be "gb|M73307|AGMA13GT", where the "gb" tag @@ -682,37 +673,38 @@ BLASTDB=LabMac:blast:data Appendix 1: The Files Produced by Formatdb ------------------------------------------ Using formatdb without the "-o T" indexing option results in three -BLAST database files (.nhr, .nin, ,nsq). Using the "-o T" option will result in -additional files. -If gi's are present in the FASTA definition lines of the source file, there will -be four additional files created (.nsd, nsi, nni, nnd). These are ISAM indices for -mapping a sequence identifier to a particular sequence in the BLAST database If -gi's are not use there will be only two additional files created (.nsd, .nsi). -These files are listed below for both an example nucleotide and a protein sequence -database. The actual sequence data is stored in the files with extension "nsq" or -"psq". The compression ratio for these files is about 4:1 for nucleotides and 1:1 -for protein sequence source files. - -Extension Content Format +BLAST database files (.nhr, .nin, ,nsq). Using the "-o T" option will result +in additional files. +If gi's are present in the FASTA definition lines of the source file, there +will be four additional files created (.nsd, nsi, nni, nnd). These are +ISAM indices for mapping a sequence identifier to a particular sequence in +the BLAST database. If gi's are not use there will be only two additional +files created (.nsd, .nsi). +These files are listed below for both an example nucleotide and a protein +sequence database. The actual sequence data is stored in the files with +extension "nsq" or "psq". The compression ratio for these files is +about 4:1 for nucleotides and 1:1 for protein sequence source files. + +Extension Content Format --------------------------------------------- Nucleotide database formatted without "-o T" - -nhr deflines binary - -nin indices binary + +nhr deflines binary + +nin indices binary -nsq sequence data binary +nsq sequence data binary Nucleotide database formatted with "-o T" add these ISAM files: -nnd GI data binary +nnd GI data binary -nni GI indices binary +nni GI indices binary -nsd non-GI data binary - -nsi non-GI indices binary +nsd non-GI data binary + +nsi non-GI indices binary The formatdb index files involving deflines are small relative to the source database due to entries such as the one below in which the @@ -731,25 +723,25 @@ GCTTAGCCACGCCCCCACGGGACACAGCAGTGATAAAAATTAAGCTATAAACGAAAGTTCGACTAAGTCATGTTAATTTA ....16398 bp total -Extension Content Format +Extension Content Format ------------------------------------------ Protein database formatted without "-o T -phr deflines binary - -pin indices binary +phr deflines binary + +pin indices binary -psq sequence data binary +psq sequence data binary Protein database formatted with "-o T" add these ISAM files: -pnd GI data binary +pnd GI data binary -pni GI indices binary +pni GI indices binary -psd non-GI data binary - -psi non-GI indices binary +psd non-GI data binary + +psi non-GI indices binary The formatdb index files involving deflines are large relative to the source database due to entries such as the one below in which the @@ -768,4 +760,4 @@ used to extract data from the BLAST databases. Readdb is part of the the NCBI toolkit (ftp://ftp.ncbi.nih.gov/toolbox/ncbi_tools/), readdb.h contains a list of supported function calls. -Last updated April 02 2001 +Last updated January 30 2004 diff --git a/doc/fwd_check.sh b/doc/fwd_check.sh index 3bc0306e..8dc7480e 100755 --- a/doc/fwd_check.sh +++ b/doc/fwd_check.sh @@ -1,5 +1,5 @@ #! /bin/sh -# $Id: fwd_check.sh,v 1.14 2003/09/29 14:04:45 lavr Exp $ +# $Id: fwd_check.sh,v 1.15 2004/01/16 19:03:45 lavr Exp $ # Author: Denis Vakatov (vakatov@ncbi,nlm.nih.gov) # Modified: Anton Lavrentiev (lavr@ncbi.nlm.nih.gov) # @@ -20,8 +20,8 @@ cat <<EOF ;130.14.22.2 5859 RETIRED ;130.14.22.8 5840 RETIRED ;130.14.22.30 5810 RETIRED -130.14.22.31 5812 OBSOLESCENT -130.14.22.32 5811 OBSOLESCENT +130.14.22.31 5812 RETIRED +130.14.22.32 5811 RETIRED 130.14.22.12 5845 INTERNAL 130.14.29.112 5860 RESERVED 130.14.29.112 5861 OK diff --git a/doc/images/seqn01.png b/doc/images/seqn01.png Binary files differindex 0436eafa..11c5aba1 100644 --- a/doc/images/seqn01.png +++ b/doc/images/seqn01.png diff --git a/doc/images/seqn02.png b/doc/images/seqn02.png Binary files differindex 409423c5..1f9f82e9 100644 --- a/doc/images/seqn02.png +++ b/doc/images/seqn02.png diff --git a/doc/images/seqn03.png b/doc/images/seqn03.png Binary files differindex 4ae67e56..751776b4 100644 --- a/doc/images/seqn03.png +++ b/doc/images/seqn03.png diff --git a/doc/images/seqn04.png b/doc/images/seqn04.png Binary files differindex 2f620327..e40337e2 100644 --- a/doc/images/seqn04.png +++ b/doc/images/seqn04.png diff --git a/doc/images/seqn05.png b/doc/images/seqn05.png Binary files differindex 85349391..e85d2536 100644 --- a/doc/images/seqn05.png +++ b/doc/images/seqn05.png diff --git a/doc/images/seqn06.png b/doc/images/seqn06.png Binary files differindex 8d216689..84859cbd 100644 --- a/doc/images/seqn06.png +++ b/doc/images/seqn06.png diff --git a/doc/images/seqn07.png b/doc/images/seqn07.png Binary files differindex 9c41ff75..5a172e28 100644 --- a/doc/images/seqn07.png +++ b/doc/images/seqn07.png diff --git a/doc/images/seqn08.png b/doc/images/seqn08.png Binary files differindex adb4f3ba..bea5944a 100644 --- a/doc/images/seqn08.png +++ b/doc/images/seqn08.png diff --git a/doc/images/seqn09.png b/doc/images/seqn09.png Binary files differindex 5995f5ec..405444da 100644 --- a/doc/images/seqn09.png +++ b/doc/images/seqn09.png diff --git a/doc/images/seqn10.png b/doc/images/seqn10.png Binary files differindex 0d35480a..00556348 100644 --- a/doc/images/seqn10.png +++ b/doc/images/seqn10.png diff --git a/doc/images/seqn11.png b/doc/images/seqn11.png Binary files differindex a5dafc3d..27d86887 100644 --- a/doc/images/seqn11.png +++ b/doc/images/seqn11.png diff --git a/doc/images/seqn12.png b/doc/images/seqn12.png Binary files differindex c12857f8..32c2c1a4 100644 --- a/doc/images/seqn12.png +++ b/doc/images/seqn12.png diff --git a/doc/images/seqn13.png b/doc/images/seqn13.png Binary files differindex 77cd5ba5..3deafbaf 100644 --- a/doc/images/seqn13.png +++ b/doc/images/seqn13.png diff --git a/doc/images/seqn14.png b/doc/images/seqn14.png Binary files differindex 9ef673b6..3974a791 100644 --- a/doc/images/seqn14.png +++ b/doc/images/seqn14.png diff --git a/doc/images/seqn15.png b/doc/images/seqn15.png Binary files differindex 6bd95104..44cf7c1c 100644 --- a/doc/images/seqn15.png +++ b/doc/images/seqn15.png diff --git a/doc/images/seqn16.png b/doc/images/seqn16.png Binary files differindex 090ae0a5..54e5c201 100644 --- a/doc/images/seqn16.png +++ b/doc/images/seqn16.png diff --git a/doc/images/seqn17.png b/doc/images/seqn17.png Binary files differindex aac50041..6b192dd0 100644 --- a/doc/images/seqn17.png +++ b/doc/images/seqn17.png diff --git a/doc/images/seqn18.png b/doc/images/seqn18.png Binary files differindex 9350c0ac..2324eeb3 100644 --- a/doc/images/seqn18.png +++ b/doc/images/seqn18.png diff --git a/doc/images/seqn19.png b/doc/images/seqn19.png Binary files differindex 75dbbeb3..d6e8a0cc 100644 --- a/doc/images/seqn19.png +++ b/doc/images/seqn19.png diff --git a/doc/images/seqn20.png b/doc/images/seqn20.png Binary files differindex a9d0df70..ca8b83f8 100644 --- a/doc/images/seqn20.png +++ b/doc/images/seqn20.png diff --git a/doc/images/seqn21.png b/doc/images/seqn21.png Binary files differindex c07f458b..240aa84c 100644 --- a/doc/images/seqn21.png +++ b/doc/images/seqn21.png diff --git a/doc/images/seqn22.png b/doc/images/seqn22.png Binary files differindex d4532f07..8d595a59 100644 --- a/doc/images/seqn22.png +++ b/doc/images/seqn22.png diff --git a/doc/man/asn2gb.1 b/doc/man/asn2gb.1 index 7986d22b..78e4d2aa 100644 --- a/doc/man/asn2gb.1 +++ b/doc/man/asn2gb.1 @@ -1,4 +1,4 @@ -.TH ASN2GB 1 2003-04-27 NCBI "NCBI Tools User's Manual" +.TH ASN2GB 1 2003-11-10 NCBI "NCBI Tools User's Manual" .SH NAME asn2gb \- convert ASN.1 biological data to a GenBank-style flat format .SH SYNOPSIS @@ -23,12 +23,12 @@ asn2gb \- convert ASN.1 biological data to a GenBank-style flat format [\|\fB\-s\fP\ \fIstyle\fP\|] [\|\fB\-t\fP\ \fIN\fP\|] [\|\fB\-u\fP\ \fIN\fP\|] -[\|\fB\-x\fP\ \fIacc\fP\|] +.\" [\|\fB\-x\fP\ \fIacc\fP\|] \" disabled [\|\fB\-y\fP\ \fIN\fP\|] .SH DESCRIPTION -\fBasn2ff\fP converts descriptions of biological sequences from NCBI's +\fBasn2gb\fP converts descriptions of biological sequences from NCBI's ASN.1 format to one of several flat-file formats, and is the successor -to \fBasn2gb\fP(1). +to \fBasn2ff\fP(1). .SH OPTIONS A summary of options is included below. .TP @@ -182,9 +182,9 @@ Hide most imported features Hide SNP features .PD .RE -.TP -\fB\-x\fP\ \fIacc\fP -Accession to extract +.\" .TP +.\" \fB\-x\fP\ \fIacc\fP +.\" Accession to extract .TP \fB\-y\fP\ \fIN\fP Feature itemID diff --git a/doc/man/blast.1 b/doc/man/blast.1 index 8c7ec8cf..0f58ced1 100644 --- a/doc/man/blast.1 +++ b/doc/man/blast.1 @@ -1,4 +1,4 @@ -.TH BLAST 1 2003-04-27 NCBI "NCBI Tools User's Manual" +.TH BLAST 1 2003-11-10 NCBI "NCBI Tools User's Manual" .SH NAME bl2seq, blastall, blastcl3, blastpgp, impala, megablast, rpsblast, seedtop \- Basic Local Alignment Search Tool .SH SYNOPSIS @@ -626,7 +626,8 @@ Do not perform gapped alignment (N/A for tblastx) Generate words for every base of the database (default is every 4th) .TP \fB\-h\fP\ \fIX\fP (blastpgp, impala) -e-value threshold for inclusion in multipass model (default = 0.005) +e-value threshold for inclusion in multipass model (default = 0.002 +for blastpgp, 0.005 for impala) .TP \fB\-i\fP\ \fIfilename\fP Read (first) sequence from \fIfilename\fP (default is stdin) diff --git a/doc/man/fastacmd.1 b/doc/man/fastacmd.1 index 588cfe33..d17795dd 100644 --- a/doc/man/fastacmd.1 +++ b/doc/man/fastacmd.1 @@ -1,4 +1,4 @@ -.TH FASTACMD 1 2003-04-27 NCBI "NCBI Tools User's Manual" +.TH FASTACMD 1 2003-11-10 NCBI "NCBI Tools User's Manual" .SH NAME fastacmd \- retrieve FASTA sequences from a BLAST database .SH SYNOPSIS @@ -96,6 +96,21 @@ commas .TP \fB\-t\fP Definition line should contain target GI only +.SH EXIT STATUS +.RS +.PD 0 +.IP 0 +Completed successfully. +.IP 1 +An error (other than those below) occurred. +.IP 2 +The BLAST database was not found. +.IP 3 +A search (accession, GI, or taxonomy info) failed. +.IP 4 +No taxonomy database was found. +.PD +.RE .SH AUTHOR The National Center for Biotechnology Information. .SH SEE ALSO diff --git a/doc/man/tbl2asn.1 b/doc/man/tbl2asn.1 index 3798b8e0..f60ec5d5 100644 --- a/doc/man/tbl2asn.1 +++ b/doc/man/tbl2asn.1 @@ -1,4 +1,4 @@ -.TH TBL2ASN 1 2003-04-27 NCBI "NCBI Tools User's Manual" +.TH TBL2ASN 1 2003-11-10 NCBI "NCBI Tools User's Manual" .SH NAME tbl2asn \- prepare a GenBank submission using an ASCII feature table .SH SYNOPSIS @@ -9,10 +9,13 @@ tbl2asn \- prepare a GenBank submission using an ASCII feature table [\|\fB\-c\fP\|] [\|\fB\-d\fP\|] [\|\fB\-g\fP\|] -[\|\fB\-f\fP\ \fIfilename\fP\|] +[\|\fB\-i\fP\ \fIfilename\fP\|] +[\|\fB\-j\fP\ \fIstr\fP\|] [\|\fB\-k\fP\|] +[\|\fB\-l\fP\|] [\|\fB\-m\fP\|] [\|\fB\-n\fP\ \fIstr\fP\|] +[\|\fB\-o\fP\ \fIfilename\fP\|] [\|\fB\-p\fP\ \fIstr\fP\|] [\|\fB\-q\fP\|] [\|\fB\-r\fP\ \fIstr\fP\|] @@ -20,6 +23,7 @@ tbl2asn \- prepare a GenBank submission using an ASCII feature table [\|\fB\-t\fP\ \fIfilename\fP\|] [\|\fB\-v\fP\|] [\|\fB\-x\fP\ \fIstr\fP\|] +[\|\fB\-y\fP\ \fIstr\fP\|] .SH DESCRIPTION \fBtbl2asn\fP reads a template along with sequence and table files, and outputs ASN.1 for submission to GenBank. Thus, the submitter does @@ -45,21 +49,30 @@ Annotate longest ORF \fB\-d\fP Read FASTAs as Delta .TP -\fB\-f\fP\ \fIfilename\fP -Read only this file -.TP \fB\-g\fP Input is a genomic product set .TP +\fB\-i\fP\ \fIfilename\fP +Single input file +.TP +\fB\-j\fP\ \fIstr\fP +Source qualifiers +.TP \fB\-k\fP Set conflict on mismatch .TP +\fB\-l\fP +Read FASTA+Gap Alignment +.TP \fB\-m\fP Allow alternative starts .TP \fB\-n\fP\ \fIstr\fP Organism name .TP +\fB\-o\fP\ \fIfilename\fP +Single output file +.TP \fB\-p\fP\ \fIstr\fP Path to files .TP @@ -80,6 +93,9 @@ Validate .TP \fB\-x\fP\ \fIstr\fP Suffix (default = \fB.fsa\fP) +.TP +\fB\-y\fP\ \fIstr\fP +Comment .SH AUTHOR The National Center for Biotechnology Information. .SH SEE ALSO diff --git a/doc/sequin.htm b/doc/sequin.htm index cbd52165..41267466 100644 --- a/doc/sequin.htm +++ b/doc/sequin.htm @@ -48,7 +48,7 @@ A Quick Guide</b> <hr> -<! use img src="http://www.ncbi.nlm.nih.gov/Sequin/QuickGuide/image##.gif" align=bottom> +<! use img src="http://www.ncbi.nlm.nih.gov/Sequin/QuickGuide/image##.png" align=bottom> <p align="left"> <font size=4> @@ -312,7 +312,7 @@ save Sequin information templates for each sequence. <br> <p align="center"> -<img src="images/seqn01.gif" align=bottom alt="Welcome to Sequin form has +<img src="images/seqn01.png" align=bottom alt="Welcome to Sequin form has push buttons to Start New Submission, Read Existing Record, Show Help, and Quit Program."> <br> @@ -348,7 +348,7 @@ to release the record immediately into the public databases. <br> <p align="center"> -<img src="images/seqn02.gif" align=bottom alt="Submission page defaults +<img src="images/seqn02.png" align=bottom alt="Submission page defaults allow immediate release of the record."> <br> @@ -364,7 +364,7 @@ it is not necessary to type periods after initials or suffixes. <br> <p align="center"> -<img src="images/seqn03.gif" align=bottom alt="Contact page has fields for +<img src="images/seqn03.png" align=bottom alt="Contact page has fields for contact person's Name, Phone, Fax, and Email."> <br> @@ -382,7 +382,7 @@ or Sr.), not academic degrees. <br> <p align="center"> -<img src="images/seqn04.gif" align=bottom alt="Authors page has a spreadsheet +<img src="images/seqn04.png" align=bottom alt="Authors page has a spreadsheet for entering an arbitrary number of authors."> <br> @@ -392,7 +392,7 @@ primary author. <br> <p align="center"> -<img src="images/seqn05.gif" align=bottom alt="Affiliation page has fields +<img src="images/seqn05.png" align=bottom alt="Affiliation page has fields for institutional mailing address."> <br> @@ -429,7 +429,7 @@ unrelated sequences, where no alignment is present or should be calculated. <br> <p align="center"> -<img src="images/seqn06.gif" align=bottom alt="Sequence Format form has controls +<img src="images/seqn06.png" align=bottom alt="Sequence Format form has controls for choosing the submission type and sequence data format."> <br> @@ -472,7 +472,7 @@ GenBank.) <br> <p align="center"> -<img src="images/seqn07.gif" align=bottom alt="Organism page has fields for +<img src="images/seqn07.png" align=bottom alt="Organism page has fields for Scientific Name, Location of Sequence, and Genetic Code for Translation"> <br> @@ -522,7 +522,7 @@ The format for annotating the nucleotide FASTA definition line is shown below: <br> <p align="center"> -<img src="images/seqn08.gif" align=bottom alt="Nucleotide page has controls +<img src="images/seqn08.png" align=bottom alt="Nucleotide page has controls for Molecule, Topology, and Incomplete at 5 prime or 3 prime end."> <br> @@ -555,7 +555,7 @@ The format for annotating the protein FASTA definition line is shown below: <br> <p align="center"> -<img src="images/seqn09.gif" align=bottom alt="Proteins page has controls +<img src="images/seqn09.png" align=bottom alt="Proteins page has controls for Incomplete at amino or carboxy end."> <br> @@ -578,7 +578,7 @@ sequence after the record is constructed. <br> <p align="center"> -<img src="images/seqn10.gif" align=bottom alt="Annotation page has controls +<img src="images/seqn10.png" align=bottom alt="Annotation page has controls for adding Gene, rRNA, or CDS features to all sequences."> <br> @@ -621,7 +621,7 @@ the missing information manually. <br> <p align="center"> -<img src="images/seqn11.gif" align=bottom alt="Product form has fields for +<img src="images/seqn11.png" align=bottom alt="Product form has fields for Sequence ID, Title, Gene Symbol, Protein Name, and Comment."> <br> @@ -656,7 +656,7 @@ form. <br> <p align="center"> -<img src="images/seqn12.gif" align=bottom alt="Source Modifiers form has a +<img src="images/seqn12.png" align=bottom alt="Source Modifiers form has a spreadsheet for entering modifiers to each individual sequence."> <br> @@ -679,7 +679,7 @@ EMBL as the database for submission in the first form). <br> <p align="center"> -<img src="images/seqn13.gif" align=bottom alt="View form has controls for +<img src="images/seqn13.png" align=bottom alt="View form has controls for Target Sequence and Display format. Default format is GenBank flatfile."> <br> @@ -717,7 +717,7 @@ products are spatially related to each other. <br> <p align="center"> -<img src="images/seqn14.gif" align=bottom alt="Graphical view has additional +<img src="images/seqn14.png" align=bottom alt="Graphical view has additional controls for Style and Scale, and displays a drawing of feature locations on the sequence coordinate."> <br> @@ -743,7 +743,7 @@ protein translations are shown as a series of tilde (~) characters. <br> <p align="center"> -<img src="images/seqn15.gif" align=bottom alt="Sequence format displays +<img src="images/seqn15.png" align=bottom alt="Sequence format displays feature locations on the actual sequence letters."> <br> @@ -822,7 +822,7 @@ large contig. <br> <p align="center"> -<img src="images/seqn16.gif" align=bottom alt="Update Sequence form +<img src="images/seqn16.png" align=bottom alt="Update Sequence form displays information on how the old and new sequences align."> <br> @@ -896,7 +896,7 @@ genetic codes, mismatched amino acids, and non-consensus splice sites. <br> <p align="center"> -<img src="images/seqn17.gif" align=bottom alt="Validator form has controls for +<img src="images/seqn17.png" align=bottom alt="Validator form has controls for Message verbosity, Severity, message Filter, and a display of error messages."> <br> @@ -960,7 +960,7 @@ tRNA, or completion of a stop codon by poly-adenylation of an mRNA. <br> <p align="center"> -<img src="images/seqn18.gif" align=bottom alt="Coding Region page has small +<img src="images/seqn18.png" align=bottom alt="Coding Region page has small folder tabs for Product, Protein, Exceptions, and Misc. Product subpage has controls for Genetic Code, Predict Interval, and Translate Product."> <br> @@ -1011,7 +1011,7 @@ database staff. <br> <p align="center"> -<img src="images/seqn19.gif" align=bottom alt="Properties page has small +<img src="images/seqn19.png" align=bottom alt="Properties page has small folder tabs for General, Comment, Citations, and Cross-Refs. General page has controls for Partial, Pseudo, Evidence, Exception, and Explanation."> <br> @@ -1031,7 +1031,7 @@ locations. <br> <p align="center"> -<img src="images/seqn20.gif" align=bottom alt="Location page has controls for +<img src="images/seqn20.png" align=bottom alt="Location page has controls for 5 prime Partial and 3 partial Partial, and a spreadsheet for entering an arbitrary number of intervals."> <br> @@ -1085,7 +1085,7 @@ both the nucleotide and protein sequences. <br> <p align="center"> -<img src="images/seqn21.gif" align=bottom alt="NCBI DeskTop window displays a +<img src="images/seqn21.png" align=bottom alt="NCBI DeskTop window displays a Venn Diagram of the internal structure of a record in the NCBI Data Model."> <br> @@ -1136,7 +1136,7 @@ sequence record. <br> <p align="center"> -<img src="images/seqn22.gif" align=bottom alt="Network Configuration form has +<img src="images/seqn22.png" align=bottom alt="Network Configuration form has buttons for Normal, Firewall, or No Connection."> <br> @@ -1477,7 +1477,7 @@ genomic records are available at <CENTER> <P CLASS=medium1><B>Questions or Comments?</B> <BR>Write to the <A HREF="mailto:info@ncbi.nlm.nih.gov">NCBI Service Desk</A></P> -<P CLASS=medium1>Revised April 14, 2003 +<P CLASS=medium1>Revised January 20, 2004 </CENTER> |
