path: root/asn/asn.all

--$Revision: 6.0 $
--**********************************************************************
--
--  asn.all
--  this file contains all NCBI ASN.1 specifications together
--
--  by James Ostell, 1990
--
--**********************************************************************

--$Revision: 6.4 $
--**********************************************************************
--
--  NCBI General Data elements
--  by James Ostell, 1990
--  Version 3.0 - June 1994
--
--**********************************************************************

NCBI-General DEFINITIONS ::=
BEGIN

EXPORTS Date, Person-id, Object-id, Dbtag, Int-fuzz, User-object;

-- StringStore is really a VisibleString.  It is used to define very
--   long strings which may need to be stored by the receiving program
--   in special structures, such as a ByteStore, but it's just a hint.
--   AsnTool stores StringStores in ByteStore structures.
-- OCTET STRINGs are also stored in ByteStores by AsnTool
-- 
-- typedef struct bsunit {             /* for building multiline strings */
   -- Nlm_Handle str;            /* the string piece */
   -- Nlm_Int2 len_avail,
       -- len;
   -- struct bsunit PNTR next; }       /* the next one */
-- Nlm_BSUnit, PNTR Nlm_BSUnitPtr;
-- 
-- typedef struct bytestore {
   -- Nlm_Int4 seekptr,       /* current position */
      -- totlen,             /* total stored data length in bytes */
      -- chain_offset;       /* offset in ByteStore of first byte in curchain */
   -- Nlm_BSUnitPtr chain,       /* chain of elements */
      -- curchain;           /* the BSUnit containing seekptr */
-- } Nlm_ByteStore, PNTR Nlm_ByteStorePtr;
--
-- AsnTool incorporates this as a primitive type, so the definition
--   is here just for completeness
-- 
--  StringStore ::= [APPLICATION 1] IMPLICIT OCTET STRING
--

-- BigInt is really an INTEGER. It is used to warn the receiving code to expect
--   a value bigger than Int4 (actually Int8). It will be stored in DataVal.bigintvalue
--
--   Like StringStore, AsnTool incorporates it as a primitive. The definition would be:
--   BigInt ::= [APPLICATION 2] IMPLICIT INTEGER
--

-- Date is used to replace the (overly complex) UTCTtime, GeneralizedTime
--  of ASN.1
--  It stores only a date
--

Date ::= CHOICE {
    str VisibleString ,        -- for those unparsed dates
    std Date-std }             -- use this if you can

Date-std ::= SEQUENCE {        -- NOTE: this is NOT a unix tm struct
    year INTEGER ,             -- full year (including 1900)
    month INTEGER OPTIONAL ,   -- month (1-12)
    day INTEGER OPTIONAL ,     -- day of month (1-31)
    season VisibleString OPTIONAL ,  -- for "spring", "may-june", etc
    hour INTEGER OPTIONAL ,    -- hour of day (0-23)
    minute INTEGER OPTIONAL ,  -- minute of hour (0-59)
    second INTEGER OPTIONAL }  -- second of minute (0-59)

-- Dbtag is generalized for tagging
-- eg. { "Social Security", str "023-79-8841" }
-- or  { "member", id 8882224 }

Dbtag ::= SEQUENCE {
    db VisibleString ,          -- name of database or system
    tag Object-id }         -- appropriate tag

-- Object-id can tag or name anything
--

Object-id ::= CHOICE {
    id INTEGER ,
    str VisibleString }

-- Person-id is to define a std element for people
--

Person-id ::= CHOICE {
    dbtag Dbtag ,               -- any defined database tag
    name Name-std ,             -- structured name
    ml VisibleString ,          -- MEDLINE name (semi-structured)
                                --    eg. "Jones RM"
    str VisibleString,          -- unstructured name
    consortium VisibleString }  -- consortium name

Name-std ::= SEQUENCE { -- Structured names
    last VisibleString ,
    first VisibleString OPTIONAL ,
    middle VisibleString OPTIONAL ,
    full VisibleString OPTIONAL ,    -- full name eg. "J. John Smith, Esq"
    initials VisibleString OPTIONAL,  -- first + middle initials
    suffix VisibleString OPTIONAL ,   -- Jr, Sr, III
    title VisibleString OPTIONAL }    -- Dr., Sister, etc

--**** Int-fuzz **********************************************
--*
--*   uncertainties in integer values

Int-fuzz ::= CHOICE {
    p-m INTEGER ,                    -- plus or minus fixed amount
    range SEQUENCE {                 -- max to min
        max INTEGER ,
        min INTEGER } ,
    pct INTEGER ,                    -- % plus or minus (x10) 0-1000
    lim ENUMERATED {                 -- some limit value
        unk (0) ,                    -- unknown
        gt (1) ,                     -- greater than
        lt (2) ,                     -- less than
        tr (3) ,                     -- space to right of position
        tl (4) ,                     -- space to left of position
        circle (5) ,                 -- artificial break at origin of circle
        other (255) } ,              -- something else
    alt SET OF INTEGER }             -- set of alternatives for the integer


--**** User-object **********************************************
--*
--*   a general object for a user defined structured data item
--*    used by Seq-feat and Seq-descr

User-object ::= SEQUENCE {
    class VisibleString OPTIONAL ,   -- endeavor which designed this object
    type Object-id ,                 -- type of object within class
    data SEQUENCE OF User-field }    -- the object itself

User-field ::= SEQUENCE {
    label Object-id ,                -- field label
    num INTEGER OPTIONAL ,           -- required for strs, ints, reals, oss
    data CHOICE {                    -- field contents
        str VisibleString ,
        int INTEGER ,
        real REAL ,
        bool BOOLEAN ,
        os OCTET STRING ,
        object User-object ,         -- for using other definitions
        strs SEQUENCE OF VisibleString ,
        ints SEQUENCE OF INTEGER ,
        reals SEQUENCE OF REAL ,
        oss SEQUENCE OF OCTET STRING ,
        fields SEQUENCE OF User-field ,
        objects SEQUENCE OF User-object } }



END

--$Revision: 6.2 $
--****************************************************************
--
--  NCBI Bibliographic data elements
--  by James Ostell, 1990
--
--  Taken from the American National Standard for
--      Bibliographic References
--      ANSI Z39.29-1977
--  Version 3.0 - June 1994
--  PubMedId added in 1996
--  ArticleIds and eprint elements added in 1999
--
--****************************************************************

NCBI-Biblio DEFINITIONS ::=
BEGIN

EXPORTS Cit-art, Cit-jour, Cit-book, Cit-pat, Cit-let, Id-pat, Cit-gen,
        Cit-proc, Cit-sub, Title, Author, PubMedId;

IMPORTS Person-id, Date, Dbtag FROM NCBI-General;

    -- Article Ids

ArticleId ::= CHOICE {         -- can be many ids for an article
	pubmed PubMedId ,      -- see types below
	medline MedlineUID ,
	doi DOI ,
	pii PII ,
	pmcid PmcID ,
	pmcpid PmcPid ,
        pmpid PmPid ,
        other Dbtag  }    -- generic catch all
    
PubMedId ::= INTEGER           -- Id from the PubMed database at NCBI
MedlineUID ::= INTEGER         -- Id from MEDLINE
DOI ::= VisibleString          -- Document Object Identifier
PII ::= VisibleString          -- Controlled Publisher Identifier
PmcID ::= INTEGER              -- PubMed Central Id
PmcPid ::= VisibleString       -- Publisher Id supplied to PubMed Central
PmPid ::= VisibleString        -- Publisher Id supplied to PubMed

ArticleIdSet ::= SET OF ArticleId

    -- Status Dates

PubStatus ::= INTEGER {            -- points of publication
    received  (1) ,            -- date manuscript received for review
    accepted  (2) ,            -- accepted for publication
    epublish  (3) ,            -- published electronically by publisher
    ppublish  (4) ,            -- published in print by publisher
    revised   (5) ,            -- article revised by publisher/author
    pmc       (6) ,            -- article first appeared in PubMed Central
    pmcr      (7) ,            -- article revision in PubMed Central
    pubmed    (8) ,            -- article citation first appeared in PubMed
    pubmedr   (9) ,            -- article citation revision in PubMed
    aheadofprint (10),         -- epublish, but will be followed by print
    premedline (11),           -- date into PreMedline status
    medline    (12),           -- date made a MEDLINE record
    other    (255) }

PubStatusDate ::= SEQUENCE {   -- done as a structure so fields can be added
    pubstatus PubStatus ,
    date Date }                -- time may be added later

PubStatusDateSet ::= SET OF PubStatusDate
    
    -- Citation Types

Cit-art ::= SEQUENCE {                  -- article in journal or book
    title Title OPTIONAL ,              -- title of paper (ANSI requires)
    authors Auth-list OPTIONAL ,        -- authors (ANSI requires)
    from CHOICE {                       -- journal or book
        journal Cit-jour ,
        book Cit-book ,
        proc Cit-proc } ,
    ids ArticleIdSet OPTIONAL }         -- lots of ids

Cit-jour ::= SEQUENCE {             -- Journal citation
    title Title ,                   -- title of journal
    imp Imprint }

Cit-book ::= SEQUENCE {              -- Book citation
    title Title ,                    -- Title of book
    coll Title OPTIONAL ,            -- part of a collection
    authors Auth-list,               -- authors
    imp Imprint }

Cit-proc ::= SEQUENCE {             -- Meeting proceedings
    book Cit-book ,                 -- citation to meeting
    meet Meeting }                  -- time and location of meeting

    -- Patent number and date-issue were made optional in 1997 to
    --   support patent applications being issued from the USPTO
    --   Semantically a Cit-pat must have either a patent number or
    --   an application number (or both) to be valid

Cit-pat ::= SEQUENCE {                  -- patent citation
    title VisibleString ,
    authors Auth-list,                  -- author/inventor
    country VisibleString ,             -- Patent Document Country
    doc-type VisibleString ,            -- Patent Document Type
    number VisibleString OPTIONAL,      -- Patent Document Number
    date-issue Date OPTIONAL,           -- Patent Issue/Pub Date
    class SEQUENCE OF VisibleString OPTIONAL ,      -- Patent Doc Class Code 
    app-number VisibleString OPTIONAL , -- Patent Doc Appl Number
    app-date Date OPTIONAL ,            -- Patent Appl File Date
    applicants Auth-list OPTIONAL ,     -- Applicants
    assignees Auth-list OPTIONAL ,      -- Assignees
    priority SEQUENCE OF Patent-priority OPTIONAL , -- Priorities
    abstract VisibleString OPTIONAL }   -- abstract of patent

Patent-priority ::= SEQUENCE {
    country VisibleString ,             -- Patent country code
    number VisibleString ,              -- number assigned in that country
    date Date }                         -- date of application

Id-pat ::= SEQUENCE {                   -- just to identify a patent
    country VisibleString ,             -- Patent Document Country
    id CHOICE {
        number VisibleString ,          -- Patent Document Number
        app-number VisibleString } ,    -- Patent Doc Appl Number
    doc-type VisibleString OPTIONAL }   -- Patent Doc Type

Cit-let ::= SEQUENCE {                  -- letter, thesis, or manuscript
    cit Cit-book ,                      -- same fields as a book
    man-id VisibleString OPTIONAL ,     -- Manuscript identifier
    type ENUMERATED {
        manuscript (1) ,
        letter (2) ,
        thesis (3) } OPTIONAL }
                                -- NOTE: this is just to cite a
                                -- direct data submission, see NCBI-Submit
                                -- for the form of a sequence submission
Cit-sub ::= SEQUENCE {               -- citation for a direct submission
    authors Auth-list ,              -- not necessarily authors of the paper
    imp Imprint OPTIONAL ,			 -- this only used to get date.. will go
    medium ENUMERATED {              -- medium of submission
        paper   (1) ,
        tape    (2) ,
        floppy  (3) ,
        email   (4) ,
        other   (255) } OPTIONAL ,
    date Date OPTIONAL ,              -- replaces imp, will become required
    descr VisibleString OPTIONAL }    -- description of changes for public view
    
Cit-gen ::= SEQUENCE {      -- NOT from ANSI, this is a catchall
    cit VisibleString OPTIONAL ,     -- anything, not parsable
    authors Auth-list OPTIONAL ,
    muid INTEGER OPTIONAL ,      -- medline uid
    journal Title OPTIONAL ,
    volume VisibleString OPTIONAL ,
    issue VisibleString OPTIONAL ,
    pages VisibleString OPTIONAL ,
    date Date OPTIONAL ,
    serial-number INTEGER OPTIONAL ,   -- for GenBank style references
    title VisibleString OPTIONAL ,     -- eg. cit="unpublished",title="title"
	pmid PubMedId OPTIONAL }           -- PubMed Id
    
    
    -- Authorship Group
Auth-list ::= SEQUENCE {
        names CHOICE {
            std SEQUENCE OF Author ,        -- full citations
            ml SEQUENCE OF VisibleString ,  -- MEDLINE, semi-structured
            str SEQUENCE OF VisibleString } , -- free for all
        affil Affil OPTIONAL }        -- author affiliation

Author ::= SEQUENCE {
    name Person-id ,                        -- Author, Primary or Secondary
    level ENUMERATED {
        primary (1),
        secondary (2) } OPTIONAL ,
    role ENUMERATED {                   -- Author Role Indicator
        compiler (1),
        editor (2),
        patent-assignee (3),
        translator (4) } OPTIONAL ,
    affil Affil OPTIONAL ,
    is-corr BOOLEAN OPTIONAL }          -- TRUE if corresponding author

Affil ::= CHOICE {
    str VisibleString ,                 -- unparsed string
    std SEQUENCE {                      -- std representation
    affil VisibleString OPTIONAL ,      -- Author Affiliation, Name
    div VisibleString OPTIONAL ,        -- Author Affiliation, Division
    city VisibleString OPTIONAL ,       -- Author Affiliation, City
    sub VisibleString OPTIONAL ,        -- Author Affiliation, County Sub
    country VisibleString OPTIONAL ,    -- Author Affiliation, Country
    street VisibleString OPTIONAL ,    -- street address, not ANSI
    email VisibleString OPTIONAL ,
    fax VisibleString OPTIONAL ,
    phone VisibleString OPTIONAL ,
    postal-code VisibleString OPTIONAL }}

    -- Title Group
    -- Valid for = A = Analytic (Cit-art)
    --             J = Journals (Cit-jour)
    --             B = Book (Cit-book)
                                                 -- Valid for:
Title ::= SET OF CHOICE {
    name VisibleString ,    -- Title, Anal,Coll,Mono    AJB
    tsub VisibleString ,    -- Title, Subordinate       A B
    trans VisibleString ,   -- Title, Translated        AJB
    jta VisibleString ,     -- Title, Abbreviated        J
    iso-jta VisibleString , -- specifically ISO jta      J
    ml-jta VisibleString ,  -- specifically MEDLINE jta  J
    coden VisibleString ,   -- a coden                   J
    issn VisibleString ,    -- ISSN                      J
    abr VisibleString ,     -- Title, Abbreviated         B
    isbn VisibleString }    -- ISBN                       B

Imprint ::= SEQUENCE {                  -- Imprint group
    date Date ,                         -- date of publication
    volume VisibleString OPTIONAL ,
    issue VisibleString OPTIONAL ,
    pages VisibleString OPTIONAL ,
    section VisibleString OPTIONAL ,
    pub Affil OPTIONAL,                     -- publisher, required for book
    cprt Date OPTIONAL,                     -- copyright date, "    "   "
    part-sup VisibleString OPTIONAL ,       -- part/sup of volume
    language VisibleString DEFAULT "ENG" ,  -- put here for simplicity
    prepub ENUMERATED {                     -- for prepublication citations
        submitted (1) ,                     -- submitted, not accepted
        in-press (2) ,                      -- accepted, not published
        other (255)  } OPTIONAL ,
    part-supi VisibleString OPTIONAL ,      -- part/sup on issue
    retract CitRetract OPTIONAL ,           -- retraction info
    pubstatus PubStatus OPTIONAL ,          -- current status of this publication
    history PubStatusDateSet OPTIONAL }     -- dates for this record

CitRetract ::= SEQUENCE {
    type ENUMERATED {                    -- retraction of an entry
        retracted (1) ,               -- this citation retracted
        notice (2) ,                  -- this citation is a retraction notice
        in-error (3) ,                -- an erratum was published about this
        erratum (4) } ,               -- this is a published erratum
    exp VisibleString OPTIONAL }      -- citation and/or explanation

Meeting ::= SEQUENCE {
    number VisibleString ,
    date Date ,
    place Affil OPTIONAL }

            
END


--$Revision: 6.0 $
--**********************************************************************
--
--  MEDLINE data definitions
--  James Ostell, 1990
--
--  enhanced in 1996 to support PubMed records as well by simply adding
--    the PubMedId and making MedlineId optional
--
--**********************************************************************

NCBI-Medline DEFINITIONS ::=
BEGIN

EXPORTS Medline-entry, Medline-si;

IMPORTS Cit-art, PubMedId FROM NCBI-Biblio
        Date FROM NCBI-General;

                                -- a MEDLINE or PubMed entry
Medline-entry ::= SEQUENCE {
    uid INTEGER OPTIONAL ,      -- MEDLINE UID, sometimes not yet available if from PubMed
    em Date ,                   -- Entry Month
    cit Cit-art ,               -- article citation
    abstract VisibleString OPTIONAL ,
    mesh SET OF Medline-mesh OPTIONAL ,
    substance SET OF Medline-rn OPTIONAL ,
    xref SET OF Medline-si OPTIONAL ,
    idnum SET OF VisibleString OPTIONAL ,  -- ID Number (grants, contracts)
    gene SET OF VisibleString OPTIONAL ,
    pmid PubMedId OPTIONAL ,               -- MEDLINE records may include the PubMedId
    pub-type SET OF VisibleString OPTIONAL, -- may show publication types (review, etc)
    mlfield SET OF Medline-field OPTIONAL ,  -- additional Medline field types
    status INTEGER {
	publisher (1) ,      -- record as supplied by publisher
        premedline (2) ,     -- premedline record
        medline (3) } DEFAULT medline }  -- regular medline record

Medline-mesh ::= SEQUENCE {
    mp BOOLEAN DEFAULT FALSE ,       -- TRUE if main point (*)
    term VisibleString ,                   -- the MeSH term
    qual SET OF Medline-qual OPTIONAL }    -- qualifiers

Medline-qual ::= SEQUENCE {
    mp BOOLEAN DEFAULT FALSE ,       -- TRUE if main point
    subh VisibleString }             -- the subheading

Medline-rn ::= SEQUENCE {       -- medline substance records
    type ENUMERATED {           -- type of record
        nameonly (0) ,
        cas (1) ,               -- CAS number
        ec (2) } ,              -- EC number
    cit VisibleString OPTIONAL ,  -- CAS or EC number if present
    name VisibleString }          -- name (always present)

Medline-si ::= SEQUENCE {       -- medline cross reference records
    type ENUMERATED {           -- type of xref
        ddbj (1) ,              -- DNA Data Bank of Japan
        carbbank (2) ,          -- Carbohydrate Structure Database
        embl (3) ,              -- EMBL Data Library
        hdb (4) ,               -- Hybridoma Data Bank
        genbank (5) ,           -- GenBank
        hgml (6) ,              -- Human Gene Map Library
        mim (7) ,               -- Mendelian Inheritance in Man
        msd (8) ,               -- Microbial Strains Database
        pdb (9) ,               -- Protein Data Bank (Brookhaven)
        pir (10) ,              -- Protein Identification Resource
        prfseqdb (11) ,         -- Protein Research Foundation (Japan)
        psd (12) ,              -- Protein Sequence Database (Japan)
        swissprot (13) ,        -- SwissProt
        gdb (14) } ,            -- Genome Data Base
    cit VisibleString OPTIONAL }    -- the citation/accession number

Medline-field ::= SEQUENCE {
    type INTEGER {              -- Keyed type
	other (0) ,             -- look in line code
	comment (1) ,           -- comment line
        erratum (2) } ,         -- retracted, corrected, etc
    str VisibleString ,         -- the text
    ids SEQUENCE OF DocRef OPTIONAL }  -- pointers relevant to this text

DocRef ::= SEQUENCE {           -- reference to a document
    type INTEGER {
        medline (1) ,
        pubmed (2) ,
        ncbigi (3) } ,
    uid INTEGER }

END

--$Revision: 6.0 $
--**********************************************************************
--
--  PUBMED data definitions
--
--**********************************************************************

NCBI-PubMed DEFINITIONS ::=
BEGIN

EXPORTS Pubmed-entry, Pubmed-url;

IMPORTS PubMedId FROM NCBI-Biblio
        Medline-entry FROM NCBI-Medline;

Pubmed-entry ::= SEQUENCE {        -- a PubMed entry
    -- PUBMED records must include the PubMedId
    pmid PubMedId,

    -- Medline entry information
    medent Medline-entry OPTIONAL,

    -- Publisher name
    publisher VisibleString OPTIONAL,

    -- List of URL to publisher cite
    urls SET OF Pubmed-url OPTIONAL,

    -- Publisher's article identifier
    pubid VisibleString OPTIONAL
}

Pubmed-url ::= SEQUENCE {
    location VisibleString OPTIONAL, -- Location code
    url VisibleString                -- Selected URL for location
}

END
--$Revision: 6.0 $
--**********************************************************************
--
--  MEDLARS data definitions
--  Grigoriy Starchenko, 1997
--
--**********************************************************************

NCBI-Medlars DEFINITIONS ::=
BEGIN

EXPORTS Medlars-entry, Medlars-record;

IMPORTS PubMedId FROM NCBI-Biblio;

Medlars-entry ::= SEQUENCE {     -- a MEDLARS entry
    pmid PubMedId,               -- All entries in PubMed must have it
    muid INTEGER OPTIONAL,       -- Medline(OCCS) id
    recs SET OF Medlars-record   -- List of Medlars records
}

Medlars-record ::= SEQUENCE {
    code INTEGER,                -- Unit record field type integer form
    abbr VisibleString OPTIONAL, -- Unit record field type abbreviation form
    data VisibleString           -- Unit record data
}

END
--$Revision: 6.0 $
--********************************************************************
--
--  Publication common set
--  James Ostell, 1990
--
--  This is the base class definitions for Publications of all sorts
--
--  support for PubMedId added in 1996
--********************************************************************

NCBI-Pub DEFINITIONS ::=
BEGIN

EXPORTS Pub, Pub-set, Pub-equiv;

IMPORTS Medline-entry FROM NCBI-Medline
        Cit-art, Cit-jour, Cit-book, Cit-proc, Cit-pat, Id-pat, Cit-gen,
        Cit-let, Cit-sub, PubMedId FROM NCBI-Biblio;

Pub ::= CHOICE {
    gen Cit-gen ,        -- general or generic unparsed
    sub Cit-sub ,        -- submission
    medline Medline-entry ,
    muid INTEGER ,       -- medline uid
    article Cit-art ,
    journal Cit-jour ,
    book Cit-book ,
    proc Cit-proc ,      -- proceedings of a meeting
    patent Cit-pat ,
    pat-id Id-pat ,      -- identify a patent
    man Cit-let ,        -- manuscript, thesis, or letter
    equiv Pub-equiv,     -- to cite a variety of ways
	pmid PubMedId }      -- PubMedId

Pub-equiv ::= SET OF Pub   -- equivalent identifiers for same citation

Pub-set ::= CHOICE {
    pub SET OF Pub ,
    medline SET OF Medline-entry ,
    article SET OF Cit-art ,
    journal SET OF Cit-jour ,
    book SET OF Cit-book ,
    proc SET OF Cit-proc ,      -- proceedings of a meeting
    patent SET OF Cit-pat }

END

--$Revision: 6.1 $
--**********************************************************************
--
--  NCBI Sequence location and identifier elements
--  by James Ostell, 1990
--
--  Version 3.0 - 1994
--
--**********************************************************************

NCBI-Seqloc DEFINITIONS ::=
BEGIN

EXPORTS Seq-id, Seq-loc, Seq-interval, Packed-seqint, Seq-point, Packed-seqpnt,
        Na-strand, Giimport-id;

IMPORTS Object-id, Int-fuzz, Dbtag, Date FROM NCBI-General
        Id-pat FROM NCBI-Biblio
        Feat-id FROM NCBI-Seqfeat;

--*** Sequence identifiers ********************************
--*

Seq-id ::= CHOICE {
    local Object-id ,      -- local use
    gibbsq INTEGER ,         -- Geninfo backbone seqid
    gibbmt INTEGER ,         -- Geninfo backbone moltype
    giim Giimport-id ,       -- Geninfo import id
    genbank Textseq-id ,
    embl Textseq-id ,
    pir Textseq-id ,
    swissprot Textseq-id ,
    patent Patent-seq-id ,
    other Textseq-id ,       -- catch all
    general Dbtag ,          -- for other databases
    gi INTEGER ,             -- GenInfo Integrated Database
    ddbj Textseq-id ,        -- DDBJ
    prf Textseq-id ,         -- PRF SEQDB
    pdb PDB-seq-id ,         -- PDB sequence
    tpg Textseq-id ,         -- Third Party Annot/Seq Genbank
    tpe Textseq-id ,         -- Third Party Annot/Seq EMBL
    tpd Textseq-id }         -- Third Party Annot/Seq DDBJ


Patent-seq-id ::= SEQUENCE {
    seqid INTEGER ,         -- number of sequence in patent
    cit Id-pat }           -- patent citation

Textseq-id ::= SEQUENCE {
    name VisibleString OPTIONAL ,
    accession VisibleString OPTIONAL ,
    release VisibleString OPTIONAL ,
    version INTEGER OPTIONAL }

Giimport-id ::= SEQUENCE {
    id INTEGER ,               -- the id to use here
    db VisibleString OPTIONAL ,  -- dbase used in
    release VisibleString OPTIONAL }   -- the release

PDB-seq-id ::= SEQUENCE {
    mol PDB-mol-id ,          -- the molecule name
    chain INTEGER DEFAULT 32 ,-- a single ASCII character, chain id
    rel Date OPTIONAL }   -- release date, month and year

PDB-mol-id ::= VisibleString  -- name of mol, 4 chars
    
--*** Sequence locations **********************************
--*

Seq-loc ::= CHOICE {
    null NULL ,           -- not placed
    empty Seq-id ,        -- to NULL one Seq-id in a collection
    whole Seq-id ,        -- whole sequence
    int Seq-interval ,    -- from to
    packed-int Packed-seqint ,
    pnt Seq-point ,
    packed-pnt Packed-seqpnt ,
    mix Seq-loc-mix ,
    equiv Seq-loc-equiv ,  -- equivalent sets of locations
    bond Seq-bond ,
    feat Feat-id }         -- indirect, through a Seq-feat
    

Seq-interval ::= SEQUENCE {
    from INTEGER ,
    to INTEGER ,
    strand Na-strand OPTIONAL ,
    id Seq-id ,    -- WARNING: this used to be optional
    fuzz-from Int-fuzz OPTIONAL ,
    fuzz-to Int-fuzz OPTIONAL }

Packed-seqint ::= SEQUENCE OF Seq-interval

Seq-point ::= SEQUENCE {
    point INTEGER ,
    strand Na-strand OPTIONAL ,
    id Seq-id ,     -- WARNING: this used to be optional
    fuzz Int-fuzz OPTIONAL }

Packed-seqpnt ::= SEQUENCE {
    strand Na-strand OPTIONAL ,
    id Seq-id ,
    fuzz Int-fuzz OPTIONAL ,
    points SEQUENCE OF INTEGER }

Na-strand ::= ENUMERATED {          -- strand of nucleid acid
    unknown (0) ,
    plus (1) ,
    minus (2) ,               
    both (3) ,                -- in forward orientation
    both-rev (4) ,            -- in reverse orientation
    other (255) }

Seq-bond ::= SEQUENCE {         -- bond between residues
    a Seq-point ,           -- connection to a least one residue
    b Seq-point OPTIONAL }  -- other end may not be available

Seq-loc-mix ::= SEQUENCE OF Seq-loc   -- this will hold anything

Seq-loc-equiv ::= SET OF Seq-loc      -- for a set of equivalent locations

END
    

--$Revision: 6.6 $
--**********************************************************************
--
--  NCBI Sequence elements
--  by James Ostell, 1990
--  Version 3.0 - June 1994
--
--**********************************************************************

NCBI-Sequence DEFINITIONS ::=
BEGIN

EXPORTS Bioseq, Seq-annot, Pubdesc, Seq-descr, Seqdesc, Numbering, Heterogen,
        Seq-hist, GIBB-mol;

IMPORTS Date, Int-fuzz, Dbtag, Object-id, User-object FROM NCBI-General
        Seq-align FROM NCBI-Seqalign
        Seq-feat FROM NCBI-Seqfeat
        Seq-graph FROM NCBI-Seqres
        Pub-equiv FROM NCBI-Pub
        Org-ref FROM NCBI-Organism
        BioSource FROM NCBI-BioSource
        Seq-id, Seq-loc FROM NCBI-Seqloc
        GB-block FROM GenBank-General
        PIR-block FROM PIR-General
        EMBL-block FROM EMBL-General
        SP-block FROM SP-General
        PRF-block FROM PRF-General
        PDB-block FROM PDB-General;

--*** Sequence ********************************
--*

Bioseq ::= SEQUENCE {
    id SET OF Seq-id ,            -- equivalent identifiers
    descr Seq-descr OPTIONAL , -- descriptors
    inst Seq-inst ,            -- the sequence data
    annot SET OF Seq-annot OPTIONAL }

--*** Descriptors *****************************
--*

Seq-descr ::= SET OF Seqdesc

Seqdesc ::= CHOICE {
    mol-type GIBB-mol ,          -- type of molecule
    modif SET OF GIBB-mod ,             -- modifiers
    method GIBB-method ,         -- sequencing method
    name VisibleString ,         -- a name for this sequence
    title VisibleString ,        -- a title for this sequence
    org Org-ref ,                -- if all from one organism
    comment VisibleString ,      -- a more extensive comment
    num Numbering ,              -- a numbering system
    maploc Dbtag ,               -- map location of this sequence
    pir PIR-block ,              -- PIR specific info
    genbank GB-block ,           -- GenBank specific info
    pub Pubdesc ,                -- a reference to the publication
    region VisibleString ,       -- overall region (globin locus)
    user User-object ,           -- user defined object
    sp SP-block ,                -- SWISSPROT specific info
    dbxref Dbtag ,               -- xref to other databases
    embl EMBL-block ,            -- EMBL specific information
    create-date Date ,           -- date entry first created/released
    update-date Date ,           -- date of last update
    prf PRF-block ,              -- PRF specific information
    pdb PDB-block ,              -- PDB specific information
    het Heterogen ,              -- cofactor, etc associated but not bound
    source BioSource ,           -- source of materials, includes Org-ref
    molinfo MolInfo }            -- info on the molecule and techniques

--******* NOTE:
--*       mol-type, modif, method, and org are consolidated and expanded
--*       in Org-ref, BioSource, and MolInfo in this specification. They
--*       will be removed in later specifications. Do not use them in the
--*       the future. Instead expect the new structures.
--*
--***************************

--********************************************************************
--
-- MolInfo gives information on the
-- classification of the type and quality of the sequence
--
-- WARNING: this will replace GIBB-mol, GIBB-mod, GIBB-method
--
--********************************************************************

MolInfo ::= SEQUENCE {
    biomol INTEGER {
        unknown (0) ,
        genomic (1) ,
        pre-RNA (2) ,              -- precursor RNA of any sort really 
        mRNA (3) ,
        rRNA (4) ,
        tRNA (5) ,
        snRNA (6) ,
        scRNA (7) ,
        peptide (8) ,
        other-genetic (9) ,      -- other genetic material
        genomic-mRNA (10) ,      -- reported a mix of genomic and cdna sequence
        cRNA (11) ,              -- viral RNA genome copy intermediate
        snoRNA (12) ,            -- small nucleolar RNA
        transcribed-RNA (13) ,   -- transcribed RNA other than existing classes
        other (255) } DEFAULT unknown ,
    tech INTEGER {
        unknown (0) ,
        standard (1) ,          -- standard sequencing
        est (2) ,               -- Expressed Sequence Tag
        sts (3) ,               -- Sequence Tagged Site
        survey (4) ,            -- one-pass genomic sequence
        genemap (5) ,           -- from genetic mapping techniques
        physmap (6) ,           -- from physical mapping techniques
        derived (7) ,           -- derived from other data, not a primary entity
        concept-trans (8) ,     -- conceptual translation
        seq-pept (9) ,          -- peptide was sequenced
        both (10) ,             -- concept transl. w/ partial pept. seq.
        seq-pept-overlap (11) , -- sequenced peptide, ordered by overlap
        seq-pept-homol (12) ,   -- sequenced peptide, ordered by homology
        concept-trans-a (13) ,  -- conceptual transl. supplied by author
        htgs-1 (14) ,           -- unordered High Throughput sequence contig
        htgs-2 (15) ,           -- ordered High Throughput sequence contig
        htgs-3 (16) ,           -- finished High Throughput sequence
        fli-cdna (17) ,         -- full length insert cDNA
        htgs-0 (18) ,           -- single genomic reads for coordination
        htc (19) ,              -- high throughput cDNA
        wgs (20) ,              -- whole genome shotgun sequencing
        other (255) }           -- use Source.techexp
               DEFAULT unknown ,
    techexp VisibleString OPTIONAL ,   -- explanation if tech not enough
    --
    -- Completeness is not indicated in most records.  For genomes, assume
    -- the sequences are incomplete unless specifically marked as complete.
    -- For mRNAs, assume the ends are not known exactly unless marked as
    -- having the left or right end.
    --
    completeness INTEGER {
      unknown (0) ,
      complete (1) ,                   -- complete biological entity
      partial (2) ,                    -- partial but no details given
      no-left (3) ,                    -- missing 5' or NH3 end
      no-right (4) ,                   -- missing 3' or COOH end
      no-ends (5) ,                    -- missing both ends
      has-left (6) ,                   -- 5' or NH3 end present
      has-right (7) ,                  -- 3' or COOH end present
      other (255) } DEFAULT unknown }


GIBB-mol ::= ENUMERATED {       -- type of molecule represented
    unknown (0) ,
    genomic (1) ,
    pre-mRNA (2) ,              -- precursor RNA of any sort really 
    mRNA (3) ,
    rRNA (4) ,
    tRNA (5) ,
    snRNA (6) ,
    scRNA (7) ,
    peptide (8) ,
    other-genetic (9) ,      -- other genetic material
    genomic-mRNA (10) ,      -- reported a mix of genomic and cdna sequence
    other (255) }
    
GIBB-mod ::= ENUMERATED {        -- GenInfo Backbone modifiers
    dna (0) ,
    rna (1) ,
    extrachrom (2) ,
    plasmid (3) ,
    mitochondrial (4) ,
    chloroplast (5) ,
    kinetoplast (6) ,
    cyanelle (7) ,
    synthetic (8) ,
    recombinant (9) ,
    partial (10) ,
    complete (11) ,
    mutagen (12) ,    -- subject of mutagenesis ?
    natmut (13) ,     -- natural mutant ?
    transposon (14) ,
    insertion-seq (15) ,
    no-left (16) ,    -- missing left end (5' for na, NH2 for aa)
    no-right (17) ,   -- missing right end (3' or COOH)
    macronuclear (18) ,
    proviral (19) ,
    est (20) ,        -- expressed sequence tag
    sts (21) ,        -- sequence tagged site
    survey (22) ,     -- one pass survey sequence
    chromoplast (23) ,
    genemap (24) ,    -- is a genetic map
    restmap (25) ,    -- is an ordered restriction map
    physmap (26) ,    -- is a physical map (not ordered restriction map)
    other (255) }

GIBB-method ::= ENUMERATED {        -- sequencing methods
    concept-trans (1) ,    -- conceptual translation
    seq-pept (2) ,         -- peptide was sequenced
    both (3) ,             -- concept transl. w/ partial pept. seq.
    seq-pept-overlap (4) , -- sequenced peptide, ordered by overlap
    seq-pept-homol (5) ,   -- sequenced peptide, ordered by homology
    concept-trans-a (6) ,  -- conceptual transl. supplied by author
    other (255) }
    
Numbering ::= CHOICE {           -- any display numbering system
    cont Num-cont ,              -- continuous numbering
    enum Num-enum ,              -- enumerated names for residues
    ref Num-ref ,                -- by reference to another sequence
    real Num-real }              -- supports mapping to a float system
    
Num-cont ::= SEQUENCE {          -- continuous display numbering system
    refnum INTEGER DEFAULT 1,         -- number assigned to first residue
    has-zero BOOLEAN DEFAULT FALSE ,  -- 0 used?
    ascending BOOLEAN DEFAULT TRUE }  -- ascending numbers?

Num-enum ::= SEQUENCE {          -- any tags to residues
    num INTEGER ,                        -- number of tags to follow
    names SEQUENCE OF VisibleString }    -- the tags

Num-ref ::= SEQUENCE {           -- by reference to other sequences
    type ENUMERATED {            -- type of reference
        not-set (0) ,
        sources (1) ,            -- by segmented or const seq sources
        aligns (2) } ,           -- by alignments given below
    aligns Seq-align OPTIONAL }

Num-real ::= SEQUENCE {          -- mapping to floating point system
    a REAL ,                     -- from an integer system used by Bioseq
    b REAL ,                     -- position = (a * int_position) + b
    units VisibleString OPTIONAL }

Pubdesc ::= SEQUENCE {              -- how sequence presented in pub
    pub Pub-equiv ,                 -- the citation(s)
    name VisibleString OPTIONAL ,   -- name used in paper
    fig VisibleString OPTIONAL ,    -- figure in paper
    num Numbering OPTIONAL ,        -- numbering from paper
    numexc BOOLEAN OPTIONAL ,       -- numbering problem with paper
    poly-a BOOLEAN OPTIONAL ,       -- poly A tail indicated in figure?
    maploc VisibleString OPTIONAL , -- map location reported in paper
    seq-raw StringStore OPTIONAL ,  -- original sequence from paper
    align-group INTEGER OPTIONAL ,  -- this seq aligned with others in paper
    comment VisibleString OPTIONAL, -- any comment on this pub in context
	reftype INTEGER {           -- type of reference in a GenBank record
		seq (0) ,               -- refers to sequence
		sites (1) ,             -- refers to unspecified features
		feats (2) ,             -- refers to specified features
		no-target (3) }         -- nothing specified (EMBL)
		DEFAULT seq }

Heterogen ::= VisibleString       -- cofactor, prosthetic group, inhibitor, etc

--*** Instances of sequences *******************************
--*

Seq-inst ::= SEQUENCE {            -- the sequence data itself
    repr ENUMERATED {              -- representation class
        not-set (0) ,              -- empty
        virtual (1) ,              -- no seq data
        raw (2) ,                  -- continuous sequence
        seg (3) ,                  -- segmented sequence
        const (4) ,                -- constructed sequence
        ref (5) ,                  -- reference to another sequence
        consen (6) ,               -- consensus sequence or pattern
        map (7) ,                  -- ordered map of any kind
        delta (8) ,              -- sequence made by changes (delta) to others
        other (255) } ,
    mol ENUMERATED {               -- molecule class in living organism
        not-set (0) ,              --   > cdna = rna
        dna (1) ,
        rna (2) ,
        aa (3) ,
        na (4) ,                   -- just a nucleic acid
        other (255) } ,
    length INTEGER OPTIONAL ,      -- length of sequence in residues
    fuzz Int-fuzz OPTIONAL ,       -- length uncertainty
    topology ENUMERATED {          -- topology of molecule
        not-set (0) ,
        linear (1) ,
        circular (2) ,
        tandem (3) ,               -- some part of tandem repeat
        other (255) } DEFAULT linear ,
    strand ENUMERATED {            -- strandedness in living organism
        not-set (0) ,
        ss (1) ,                   -- single strand
        ds (2) ,                   -- double strand
        mixed (3) ,
        other (255) } OPTIONAL ,   -- default ds for DNA, ss for RNA, pept
    seq-data Seq-data OPTIONAL ,   -- the sequence
    ext Seq-ext OPTIONAL ,         -- extensions for special types
    hist Seq-hist OPTIONAL }       -- sequence history

--*** Sequence Extensions **********************************
--*  for representing more complex types
--*  const type uses Seq-hist.assembly

Seq-ext ::= CHOICE {
    seg Seg-ext ,        -- segmented sequences
    ref Ref-ext ,        -- hot link to another sequence (a view)
    map Map-ext ,        -- ordered map of markers
    delta Delta-ext }

Seg-ext ::= SEQUENCE OF Seq-loc

Ref-ext ::= Seq-loc

Map-ext ::= SEQUENCE OF Seq-feat

Delta-ext ::= SEQUENCE OF Delta-seq

Delta-seq ::= CHOICE {
    loc Seq-loc ,       -- point to a sequence
    literal Seq-literal }   -- a piece of sequence

Seq-literal ::= SEQUENCE {
    length INTEGER ,         -- must give a length in residues
    fuzz Int-fuzz OPTIONAL , -- could be unsure
    seq-data Seq-data OPTIONAL } -- may have the data

--*** Sequence History Record ***********************************
--** assembly = records how seq was assembled from others
--** replaces = records sequences made obsolete by this one
--** replaced-by = this seq is made obsolete by another(s)

Seq-hist ::= SEQUENCE {
    assembly SET OF Seq-align OPTIONAL ,-- how was this assembled?
    replaces Seq-hist-rec OPTIONAL ,    -- seq makes these seqs obsolete
    replaced-by Seq-hist-rec OPTIONAL , -- these seqs make this one obsolete
    deleted CHOICE {
        bool BOOLEAN ,
        date Date } OPTIONAL }

Seq-hist-rec ::= SEQUENCE {
    date Date OPTIONAL ,
    ids SET OF Seq-id }
    
--*** Various internal sequence representations ************
--*      all are controlled, fixed length forms

Seq-data ::= CHOICE {              -- sequence representations
    iupacna IUPACna ,              -- IUPAC 1 letter nuc acid code
    iupacaa IUPACaa ,              -- IUPAC 1 letter amino acid code
    ncbi2na NCBI2na ,              -- 2 bit nucleic acid code
    ncbi4na NCBI4na ,              -- 4 bit nucleic acid code
    ncbi8na NCBI8na ,              -- 8 bit extended nucleic acid code
    ncbipna NCBIpna ,              -- nucleic acid probabilities
    ncbi8aa NCBI8aa ,              -- 8 bit extended amino acid codes
    ncbieaa NCBIeaa ,              -- extended ASCII 1 letter aa codes
    ncbipaa NCBIpaa ,              -- amino acid probabilities
    ncbistdaa NCBIstdaa }          -- consecutive codes for std aas


IUPACna ::= StringStore       -- IUPAC 1 letter codes, no spaces
IUPACaa ::= StringStore       -- IUPAC 1 letter codes, no spaces
NCBI2na ::= OCTET STRING      -- 00=A, 01=C, 10=G, 11=T
NCBI4na ::= OCTET STRING      -- 1 bit each for agct
                              -- 0001=A, 0010=C, 0100=G, 1000=T/U
                              -- 0101=Purine, 1010=Pyrimidine, etc
NCBI8na ::= OCTET STRING      -- for modified nucleic acids
NCBIpna ::= OCTET STRING      -- 5 octets/base, prob for a,c,g,t,n
                              -- probabilities are coded 0-255 = 0.0-1.0
NCBI8aa ::= OCTET STRING      -- for modified amino acids
NCBIeaa ::= StringStore       -- ASCII extended 1 letter aa codes
                              -- IUPAC codes + U=selenocysteine
NCBIpaa ::= OCTET STRING      -- 25 octets/aa, prob for IUPAC aas in order:
                              -- A-Y,B,Z,X,(ter),anything
                              -- probabilities are coded 0-255 = 0.0-1.0
NCBIstdaa ::= OCTET STRING    -- codes 0-25, 1 per byte

--*** Sequence Annotation *************************************
--*

Annot-id ::= CHOICE {
    local Object-id ,
    ncbi INTEGER ,
    general Dbtag }
    
Annot-descr ::= SET OF Annotdesc

Annotdesc ::= CHOICE {
    name VisibleString ,         -- a short name for this collection
    title VisibleString ,        -- a title for this collection
    comment VisibleString ,      -- a more extensive comment
    pub Pubdesc ,                -- a reference to the publication
    user User-object ,           -- user defined object
    create-date Date ,           -- date entry first created/released
    update-date Date ,           -- date of last update
    src Seq-id ,                 -- source sequence from which annot came
    align Align-def,             -- definition of the SeqAligns
    region Seq-loc }             -- all contents cover this region

Align-def ::= SEQUENCE {
    align-type INTEGER {         -- class of align Seq-annot
      ref (1) ,                  -- set of alignments to the same sequence
      alt (2) ,                  -- set of alternate alignments of the same seqs
      blocks (3) ,               -- set of aligned blocks in the same seqs
      other (255) } ,
    ids SET OF Seq-id OPTIONAL } -- used for the one ref seqid for now

Seq-annot ::= SEQUENCE {
    id SET OF Annot-id OPTIONAL ,
    db INTEGER {                 -- source of annotation
        genbank (1) ,
        embl (2) ,
        ddbj (3) ,
        pir  (4) ,
        sp   (5) ,
        bbone (6) ,
        pdb   (7) ,
        other (255) } OPTIONAL ,
    name VisibleString OPTIONAL ,-- source if "other" above
    desc Annot-descr OPTIONAL ,  -- used only for stand alone Seq-annots
    data CHOICE {
        ftable SET OF Seq-feat ,
        align SET OF Seq-align ,
        graph SET OF Seq-graph ,
        ids SET OF Seq-id ,        -- used for communication between tools
        locs SET OF Seq-loc } }    -- used for communication between tools

END


--$Revision: 6.1 $
--**********************************************************************
--
--  NCBI Sequence Collections
--  by James Ostell, 1990
--
--  Version 3.0 - 1994
--
--**********************************************************************

NCBI-Seqset DEFINITIONS ::=
BEGIN

EXPORTS Bioseq-set, Seq-entry;

IMPORTS Bioseq, Seq-annot, Seq-descr FROM NCBI-Sequence
        Object-id, Dbtag, Date FROM NCBI-General;

--*** Sequence Collections ********************************
--*

Bioseq-set ::= SEQUENCE {      -- just a collection
    id Object-id OPTIONAL ,
    coll Dbtag OPTIONAL ,          -- to identify a collection
    level INTEGER OPTIONAL ,       -- nesting level
    class ENUMERATED {
        not-set (0) ,
        nuc-prot (1) ,              -- nuc acid and coded proteins
        segset (2) ,                -- segmented sequence + parts
        conset (3) ,                -- constructed sequence + parts
        parts (4) ,                 -- parts for 2 or 3
        gibb (5) ,                  -- geninfo backbone
        gi (6) ,                    -- geninfo
        genbank (7) ,               -- converted genbank
        pir (8) ,                   -- converted pir
        pub-set (9) ,               -- all the seqs from a single publication
        equiv (10) ,                -- a set of equivalent maps or seqs
        swissprot (11) ,            -- converted SWISSPROT
        pdb-entry (12) ,            -- a complete PDB entry
        mut-set (13) ,              -- set of mutations
        pop-set (14) ,              -- population study
        phy-set (15) ,              -- phylogenetic study
	eco-set (16) ,              -- ecological sample study
        gen-prod-set (17) ,         -- genomic products, chrom+mRNa+protein  
        other (255) } DEFAULT not-set ,
    release VisibleString OPTIONAL ,
    date Date OPTIONAL ,
    descr Seq-descr OPTIONAL ,
    seq-set SEQUENCE OF Seq-entry ,
    annot SET OF Seq-annot OPTIONAL }

Seq-entry ::= CHOICE {
        seq Bioseq ,
        set Bioseq-set } 

END

--$Revision: 6.0 $
--  *********************************************************************
--
--  These are code and conversion tables for NCBI sequence codes
--  ASN.1 for the sequences themselves are define in seq.asn
--
--  Seq-map-table and Seq-code-table REQUIRE that codes start with 0
--    and increase continuously.  So IUPAC codes, which are upper case
--    letters will always have 65 0 cells before the codes begin.  This
--    allows all codes to do indexed lookups for things
--
--  Valid names for code tables are:
--    IUPACna
--    IUPACaa
--    IUPACeaa
--    IUPACaa3     3 letter amino acid codes : parallels IUPACeaa
--                   display only, not a data exchange type
--    NCBI2na
--    NCBI4na
--    NCBI8na
--    NCBI8aa
--    NCBIstdaa
--     probability types map to IUPAC types for display as characters

NCBI-SeqCode DEFINITIONS ::=
BEGIN

EXPORTS Seq-code-table, Seq-map-table, Seq-code-set;

Seq-code-type ::= ENUMERATED {              -- sequence representations
    iupacna (1) ,              -- IUPAC 1 letter nuc acid code
    iupacaa (2) ,              -- IUPAC 1 letter amino acid code
    ncbi2na (3) ,              -- 2 bit nucleic acid code
    ncbi4na (4) ,              -- 4 bit nucleic acid code
    ncbi8na (5) ,              -- 8 bit extended nucleic acid code
    ncbipna (6) ,              -- nucleic acid probabilities
    ncbi8aa (7) ,              -- 8 bit extended amino acid codes
    ncbieaa (8) ,              -- extended ASCII 1 letter aa codes
    ncbipaa (9) ,              -- amino acid probabilities
    iupacaa3 (10) ,            -- 3 letter code only for display
    ncbistdaa (11) }           -- consecutive codes for std aas, 0-25

Seq-map-table ::= SEQUENCE { -- for tables of sequence mappings 
    from Seq-code-type ,      -- code to map from
    to Seq-code-type ,        -- code to map to
    num INTEGER ,             -- number of rows in table
    start-at INTEGER DEFAULT 0 ,   -- index offset of first element
    table SEQUENCE OF INTEGER }  -- table of values, in from-to order

Seq-code-table ::= SEQUENCE { -- for names of coded values
    code Seq-code-type ,      -- name of code
    num INTEGER ,             -- number of rows in table
    one-letter BOOLEAN ,   -- symbol is ALWAYS 1 letter?
    start-at INTEGER DEFAULT 0 ,   -- index offset of first element
    table SEQUENCE OF
        SEQUENCE {
            symbol VisibleString ,      -- the printed symbol or letter
            name VisibleString } ,      -- an explanatory name or string
    comps SEQUENCE OF INTEGER OPTIONAL } -- pointers to complement nuc acid

Seq-code-set ::= SEQUENCE {    -- for distribution
    codes SET OF Seq-code-table OPTIONAL ,
    maps SET OF Seq-map-table OPTIONAL }

END

--$Revision: 6.0 $
--*********************************************************************
--
-- 1990 - J.Ostell
-- Version 3.0 - June 1994
--
--*********************************************************************
--*********************************************************************
--
--  EMBL specific data
--  This block of specifications was developed by Reiner Fuchs of EMBL
--  Updated by J.Ostell, 1994
--
--*********************************************************************

EMBL-General DEFINITIONS ::=
BEGIN

EXPORTS EMBL-dbname, EMBL-xref, EMBL-block;

IMPORTS Date, Object-id FROM NCBI-General;

EMBL-dbname ::= CHOICE {
    code ENUMERATED {
        embl(0),
        genbank(1),
        ddbj(2),
        geninfo(3),
        medline(4),
        swissprot(5),
        pir(6),
        pdb(7),
        epd(8),
        ecd(9),
        tfd(10),
        flybase(11),
        prosite(12),
        enzyme(13),
        mim(14),
        ecoseq(15),
        hiv(16) ,
        other (255) } ,
    name    VisibleString }

EMBL-xref ::= SEQUENCE {
    dbname EMBL-dbname,
    id SEQUENCE OF Object-id }

EMBL-block ::= SEQUENCE {
    class ENUMERATED {
        not-set(0),
        standard(1),
        unannotated(2),
        other(255) } DEFAULT standard,
    div ENUMERATED {
        fun(0),
        inv(1),
        mam(2),
        org(3),
        phg(4),
        pln(5),
        pri(6),
        pro(7),
        rod(8),
        syn(9),
        una(10),
        vrl(11),
        vrt(12),
        pat(13),
        est(14),
        sts(15),
        other (255) } OPTIONAL,
    creation-date Date,
    update-date Date,
    extra-acc SEQUENCE OF VisibleString OPTIONAL,
    keywords SEQUENCE OF VisibleString OPTIONAL,
    xref SEQUENCE OF EMBL-xref OPTIONAL }

END

--*********************************************************************
--
--  SWISSPROT specific data
--  This block of specifications was developed by Mark Cavanaugh of
--      NCBI working with Amos Bairoch of SWISSPROT
--
--*********************************************************************

SP-General DEFINITIONS ::=
BEGIN

EXPORTS SP-block;

IMPORTS Date, Dbtag FROM NCBI-General
        Seq-id FROM NCBI-Seqloc;

SP-block ::= SEQUENCE {         -- SWISSPROT specific descriptions
    class ENUMERATED {
        not-set (0) ,
        standard (1) ,      -- conforms to all SWISSPROT checks
        prelim (2) ,        -- only seq and biblio checked
        other (255) } ,
    extra-acc SET OF VisibleString OPTIONAL ,  -- old SWISSPROT ids
    imeth BOOLEAN DEFAULT FALSE ,  -- seq known to start with Met
    plasnm SET OF VisibleString OPTIONAL,  -- plasmid names carrying gene
    seqref SET OF Seq-id OPTIONAL,         -- xref to other sequences
    dbref SET OF Dbtag OPTIONAL ,          -- xref to non-sequence dbases
    keywords SET OF VisibleString OPTIONAL , -- keywords
    created Date OPTIONAL ,         -- creation date
    sequpd Date OPTIONAL ,          -- sequence update
    annotupd Date OPTIONAL }        -- annotation update

END

--*********************************************************************
--
--  PIR specific data
--  This block of specifications was developed by Jim Ostell of
--      NCBI
--
--*********************************************************************

PIR-General DEFINITIONS ::=
BEGIN

EXPORTS PIR-block;

IMPORTS Seq-id FROM NCBI-Seqloc;

PIR-block ::= SEQUENCE {          -- PIR specific descriptions
    had-punct BOOLEAN OPTIONAL ,      -- had punctuation in sequence ?
    host VisibleString OPTIONAL ,
    source VisibleString OPTIONAL ,     -- source line
    summary VisibleString OPTIONAL ,
    genetic VisibleString OPTIONAL ,
    includes VisibleString OPTIONAL ,
    placement VisibleString OPTIONAL ,
    superfamily VisibleString OPTIONAL ,
    keywords SEQUENCE OF VisibleString OPTIONAL ,
    cross-reference VisibleString OPTIONAL ,
    date VisibleString OPTIONAL ,
    seq-raw VisibleString OPTIONAL ,  -- seq with punctuation
    seqref SET OF Seq-id OPTIONAL }         -- xref to other sequences

END

--*********************************************************************
--
--  GenBank specific data
--  This block of specifications was developed by Jim Ostell of
--      NCBI
--
--*********************************************************************

GenBank-General DEFINITIONS ::=
BEGIN

EXPORTS GB-block;

IMPORTS Date FROM NCBI-General;

GB-block ::= SEQUENCE {          -- GenBank specific descriptions
    extra-accessions SEQUENCE OF VisibleString OPTIONAL ,
    source VisibleString OPTIONAL ,     -- source line
    keywords SEQUENCE OF VisibleString OPTIONAL ,
    origin VisibleString OPTIONAL,
    date VisibleString OPTIONAL ,       -- OBSOLETE old form Entry Date
    entry-date Date OPTIONAL ,          -- replaces date
    div VisibleString OPTIONAL ,        -- GenBank division
    taxonomy VisibleString OPTIONAL }   -- continuation line of organism

END

--**********************************************************************
-- PRF specific definition
--    PRF is a protein sequence database crated and maintained by
--    Protein Research Foundation, Minoo-city, Osaka, Japan.
--
--    Written by A.Ogiwara, Inst.Chem.Res. (Dr.Kanehisa's Lab),
--            Kyoto Univ., Japan
--
--**********************************************************************

PRF-General DEFINITIONS ::=
BEGIN

EXPORTS PRF-block;

PRF-block ::= SEQUENCE {
      extra-src       PRF-ExtraSrc OPTIONAL,
      keywords        SEQUENCE OF VisibleString OPTIONAL
}

PRF-ExtraSrc ::= SEQUENCE {
      host    VisibleString OPTIONAL,
      part    VisibleString OPTIONAL,
      state   VisibleString OPTIONAL,
      strain  VisibleString OPTIONAL,
      taxon   VisibleString OPTIONAL
}

END

--*********************************************************************
--
--  PDB specific data
--  This block of specifications was developed by Jim Ostell and
--      Steve Bryant of NCBI
--
--*********************************************************************

PDB-General DEFINITIONS ::=
BEGIN

EXPORTS PDB-block;

IMPORTS Date FROM NCBI-General;

PDB-block ::= SEQUENCE {          -- PDB specific descriptions
    deposition Date ,         -- deposition date  month,year
    class VisibleString ,
    compound SEQUENCE OF VisibleString ,
    source SEQUENCE OF VisibleString ,
    exp-method VisibleString OPTIONAL ,  -- present if NOT X-ray diffraction
    replace PDB-replace OPTIONAL } -- replacement history

PDB-replace ::= SEQUENCE {
    date Date ,
    ids SEQUENCE OF VisibleString }   -- entry ids replace by this one

END

--$Revision: 6.9 $
--**********************************************************************
--
--  NCBI Sequence Feature elements
--  by James Ostell, 1990
--  Version 3.0 - June 1994
--
--**********************************************************************

NCBI-Seqfeat DEFINITIONS ::=
BEGIN

EXPORTS Seq-feat, Feat-id, Genetic-code;

IMPORTS Gene-ref FROM NCBI-Gene
        Prot-ref FROM NCBI-Protein
        Org-ref FROM NCBI-Organism
        BioSource FROM NCBI-BioSource
        RNA-ref FROM NCBI-RNA
        Seq-loc, Giimport-id FROM NCBI-Seqloc
        Pubdesc, Numbering, Heterogen FROM NCBI-Sequence
        Rsite-ref FROM NCBI-Rsite
        Txinit FROM NCBI-TxInit
        Pub-set FROM NCBI-Pub
        Object-id, Dbtag, User-object FROM NCBI-General;

--*** Feature identifiers ********************************
--*

Feat-id ::= CHOICE {
    gibb INTEGER ,            -- geninfo backbone
    giim Giimport-id ,        -- geninfo import
    local Object-id ,         -- for local software use
    general Dbtag }           -- for use by various databases

--*** Seq-feat *******************************************
--*  sequence feature generalization

Seq-feat ::= SEQUENCE {
    id Feat-id OPTIONAL ,
    data SeqFeatData ,           -- the specific data
    partial BOOLEAN OPTIONAL ,    -- incomplete in some way?
    except BOOLEAN OPTIONAL ,     -- something funny about this?
    comment VisibleString OPTIONAL ,
    product Seq-loc OPTIONAL ,    -- product of process
    location Seq-loc ,            -- feature made from
    qual SEQUENCE OF Gb-qual OPTIONAL ,  -- qualifiers
    title VisibleString OPTIONAL ,   -- for user defined label
    ext User-object OPTIONAL ,    -- user defined structure extension
    cit Pub-set OPTIONAL ,        -- citations for this feature
    exp-ev ENUMERATED {           -- evidence for existence of feature
        experimental (1) ,        -- any reasonable experimental check
        not-experimental (2) } OPTIONAL , -- similarity, pattern, etc
    xref SET OF SeqFeatXref OPTIONAL ,   -- cite other relevant features
    dbxref SET OF Dbtag OPTIONAL ,  -- support for xref to other databases
    pseudo BOOLEAN OPTIONAL ,     -- annotated on pseudogene?
    except-text VisibleString OPTIONAL } -- explain if except=TRUE

SeqFeatData ::= CHOICE {
    gene Gene-ref ,
    org Org-ref ,
    cdregion Cdregion ,
    prot Prot-ref ,
    rna RNA-ref ,
    pub Pubdesc ,              -- publication applies to this seq 
    seq Seq-loc ,              -- to annotate origin from another seq
    imp Imp-feat ,
    region VisibleString,      -- named region (globin locus)
    comment NULL ,             -- just a comment
    bond ENUMERATED {
        disulfide (1) ,
        thiolester (2) ,
        xlink (3) ,
        thioether (4) ,
        other (255) } ,
    site ENUMERATED {
        active (1) ,
        binding (2) ,
        cleavage (3) ,
        inhibit (4) ,
        modified (5),
        glycosylation (6) ,
        myristoylation (7) ,
        mutagenized (8) ,
        metal-binding (9) ,
        phosphorylation (10) ,
        acetylation (11) ,
        amidation (12) ,
        methylation (13) ,
        hydroxylation (14) ,
        sulfatation (15) ,
        oxidative-deamination (16) ,
        pyrrolidone-carboxylic-acid (17) ,
        gamma-carboxyglutamic-acid (18) ,
        blocked (19) ,
        lipid-binding (20) ,
        np-binding (21) ,
        dna-binding (22) ,
        signal-peptide (23) ,
        transit-peptide (24) ,
        transmembrane-region (25) ,
        other (255) } ,
    rsite Rsite-ref ,       -- restriction site  (for maps really)
    user User-object ,      -- user defined structure
    txinit Txinit ,         -- transcription initiation
    num Numbering ,         -- a numbering system
    psec-str ENUMERATED {   -- protein secondary structure
        helix (1) ,         -- any helix
        sheet (2) ,         -- beta sheet
        turn  (3) } ,       -- beta or gamma turn
    non-std-residue VisibleString ,  -- non-standard residue here in seq
    het Heterogen ,         -- cofactor, prosthetic grp, etc, bound to seq
    biosrc BioSource }

SeqFeatXref ::= SEQUENCE {       -- both optional because can have one or both
    id Feat-id OPTIONAL ,        -- the feature copied
    data SeqFeatData OPTIONAL }  -- the specific data
    
--*** CdRegion ***********************************************
--*
--*  Instructions to translate from a nucleic acid to a peptide
--*    conflict means it's supposed to translate but doesn't
--*


Cdregion ::= SEQUENCE {
    orf BOOLEAN OPTIONAL ,             -- just an ORF ?
    frame ENUMERATED {
        not-set (0) ,                  -- not set, code uses one
        one (1) ,
        two (2) ,
        three (3) } DEFAULT not-set ,      -- reading frame
    conflict BOOLEAN OPTIONAL ,        -- conflict
    gaps INTEGER OPTIONAL ,            -- number of gaps on conflict/except
    mismatch INTEGER OPTIONAL ,        -- number of mismatches on above
    code Genetic-code OPTIONAL ,       -- genetic code used
    code-break SEQUENCE OF Code-break OPTIONAL ,   -- individual exceptions
    stops INTEGER OPTIONAL }           -- number of stop codons on above

                    -- each code is 64 cells long, in the order where
                    -- T=0,C=1,A=2,G=3, TTT=0, TTC=1, TCA=4, etc
                    -- NOTE: this order does NOT correspond to a Seq-data
                    -- encoding.  It is "natural" to codon usage instead.
                    -- the value in each cell is the AA coded for
                    -- start= AA coded only if first in peptide
                    --   in start array, if codon is not a legitimate start
                    --   codon, that cell will have the "gap" symbol for
                    --   that alphabet.  Otherwise it will have the AA
                    --   encoded when that codon is used at the start.

Genetic-code ::= SET OF CHOICE {
    name VisibleString ,               -- name of a code
    id INTEGER ,                       -- id in dbase
    ncbieaa VisibleString ,            -- indexed to IUPAC extended
    ncbi8aa OCTET STRING ,             -- indexed to NCBI8aa
    ncbistdaa OCTET STRING ,           -- indexed to NCBIstdaa
    sncbieaa VisibleString ,            -- start, indexed to IUPAC extended
    sncbi8aa OCTET STRING ,             -- start, indexed to NCBI8aa
    sncbistdaa OCTET STRING }           -- start, indexed to NCBIstdaa

Code-break ::= SEQUENCE {              -- specific codon exceptions
    loc Seq-loc ,                      -- location of exception
    aa CHOICE {                        -- the amino acid
        ncbieaa INTEGER ,              -- ASCII value of NCBIeaa code
        ncbi8aa INTEGER ,              -- NCBI8aa code
        ncbistdaa INTEGER } }           -- NCBIstdaa code

Genetic-code-table ::= SET OF Genetic-code     -- table of genetic codes

--*** Import ***********************************************
--*
--*  Features imported from other databases
--*

Imp-feat ::= SEQUENCE {
    key VisibleString ,
    loc VisibleString OPTIONAL ,         -- original location string
    descr VisibleString OPTIONAL }       -- text description

Gb-qual ::= SEQUENCE {
    qual VisibleString ,
    val VisibleString }

END 

--**********************************************************************
--
--  NCBI Restriction Sites
--  by James Ostell, 1990
--  version 0.8
--
--**********************************************************************

NCBI-Rsite DEFINITIONS ::=
BEGIN

EXPORTS Rsite-ref;

IMPORTS Dbtag FROM NCBI-General;

Rsite-ref ::= CHOICE {
    str VisibleString ,     -- may be unparsable
    db  Dbtag }             -- pointer to a restriction site database

END

--**********************************************************************
--
--  NCBI RNAs
--  by James Ostell, 1990
--  version 0.8
--
--**********************************************************************

NCBI-RNA DEFINITIONS ::=
BEGIN

EXPORTS RNA-ref, Trna-ext;

IMPORTS Seq-loc FROM NCBI-Seqloc;

--*** rnas ***********************************************
--*
--*  various rnas
--*
                         -- minimal RNA sequence
RNA-ref ::= SEQUENCE {
    type ENUMERATED {            -- type of RNA feature
        unknown (0) ,
        premsg (1) ,
        mRNA (2) ,
        tRNA (3) ,
        rRNA (4) ,
        snRNA (5) ,
        scRNA (6) ,
        snoRNA (7) ,
        other (255) } ,
    pseudo BOOLEAN OPTIONAL ,  
    ext CHOICE {
        name VisibleString ,        -- for naming "other" type
        tRNA Trna-ext } OPTIONAL }  -- for tRNAs

Trna-ext ::= SEQUENCE {                 -- tRNA feature extensions
    aa CHOICE {                         -- aa this carries
        iupacaa INTEGER ,
        ncbieaa INTEGER ,
        ncbi8aa INTEGER ,
        ncbistdaa INTEGER } OPTIONAL ,
    codon SET OF INTEGER OPTIONAL ,     -- codon(s) as in Genetic-code
	anticodon Seq-loc OPTIONAL }        -- location of anticodon

END

--**********************************************************************
--
--  NCBI Genes
--  by James Ostell, 1990
--  version 0.8
--
--**********************************************************************

NCBI-Gene DEFINITIONS ::=
BEGIN

EXPORTS Gene-ref;

IMPORTS Dbtag FROM NCBI-General;

--*** Gene ***********************************************
--*
--*  reference to a gene
--*

Gene-ref ::= SEQUENCE {
    locus VisibleString OPTIONAL ,        -- Official gene symbol
    allele VisibleString OPTIONAL ,       -- Official allele designation
    desc VisibleString OPTIONAL ,         -- descriptive name
    maploc VisibleString OPTIONAL ,       -- descriptive map location
    pseudo BOOLEAN DEFAULT FALSE ,        -- pseudogene
    db SET OF Dbtag OPTIONAL ,            -- ids in other dbases
    syn SET OF VisibleString OPTIONAL ,   -- synonyms for locus
    locus-tag VisibleString OPTIONAL }    -- systematic gene name (e.g., MI0001, ORF0069)

END


--**********************************************************************
--
--  NCBI Organism
--  by James Ostell, 1994
--  version 3.0
--
--**********************************************************************

NCBI-Organism DEFINITIONS ::=
BEGIN

EXPORTS Org-ref;

IMPORTS Dbtag FROM NCBI-General;

--*** Org-ref ***********************************************
--*
--*  Reference to an organism
--*     defines only the organism.. lower levels of detail for biological
--*     molecules are provided by the Source object
--*

Org-ref ::= SEQUENCE {
    taxname VisibleString OPTIONAL ,   -- preferred formal name
    common VisibleString OPTIONAL ,    -- common name
    mod SET OF VisibleString OPTIONAL , -- unstructured modifiers
    db SET OF Dbtag OPTIONAL ,         -- ids in taxonomic or culture dbases
    syn SET OF VisibleString OPTIONAL ,  -- synonyms for taxname or common
    orgname OrgName OPTIONAL }
    

OrgName ::= SEQUENCE {
    name CHOICE {
        binomial BinomialOrgName ,         -- genus/species type name
        virus VisibleString ,              -- virus names are different
        hybrid MultiOrgName ,              -- hybrid between organisms
        namedhybrid BinomialOrgName ,      -- some hybrids have genus x species name
        partial PartialOrgName } OPTIONAL , -- when genus not known
    attrib VisibleString OPTIONAL ,        -- attribution of name
    mod SEQUENCE OF OrgMod OPTIONAL ,
    lineage VisibleString OPTIONAL ,       -- lineage with semicolon separators
    gcode INTEGER OPTIONAL ,               -- genetic code (see CdRegion)
    mgcode INTEGER OPTIONAL ,              -- mitochondrial genetic code
    div VisibleString OPTIONAL }           -- GenBank division code
    

OrgMod ::= SEQUENCE {
    subtype INTEGER {
        strain (2) ,
        substrain (3) ,
        type (4) ,
        subtype (5) ,
        variety (6) ,
        serotype (7) ,
        serogroup (8) ,
        serovar (9) ,
        cultivar (10) ,
        pathovar (11) ,
        chemovar (12) ,
        biovar (13) ,
        biotype (14) ,
        group (15) ,
        subgroup (16) ,
        isolate (17) ,
        common (18) ,
        acronym (19) ,
        dosage (20) ,		-- chromosome dosage of hybrid
        nat-host (21) ,		-- natural host of this specimen
        sub-species (22) ,
        specimen-voucher (23) ,
        authority (24) ,
        forma (25) ,
        forma-specialis (26) ,
        ecotype (27) ,
        synonym (28) ,
        anamorph (29) ,
        teleomorph (30) ,
        breed (31) ,
        gb-acronym (32) ,       -- used by taxonomy database
        gb-anamorph (33) ,      -- used by taxonomy database
        gb-synonym (34) ,       -- used by taxonomy database
        old-lineage (253) ,
        old-name (254) ,
        other (255) } ,         -- ASN5: old-name (254) will be added to next spec
    subname VisibleString ,
    attrib VisibleString OPTIONAL }  -- attribution/source of name

BinomialOrgName ::= SEQUENCE {
    genus VisibleString ,               -- required
    species VisibleString OPTIONAL ,    -- species required if subspecies used
    subspecies VisibleString OPTIONAL }

MultiOrgName ::= SEQUENCE OF OrgName   -- the first will be used to assign division

PartialOrgName ::= SEQUENCE OF TaxElement  -- when we don't know the genus

TaxElement ::= SEQUENCE {
    fixed-level INTEGER {
       other (0) ,                     -- level must be set in string
       family (1) ,
       order (2) ,
       class (3) } ,
    level VisibleString OPTIONAL ,
    name VisibleString }

END


--**********************************************************************
--
--  NCBI BioSource
--  by James Ostell, 1994
--  version 3.0
--
--**********************************************************************

NCBI-BioSource DEFINITIONS ::=
BEGIN

EXPORTS BioSource;

IMPORTS Org-ref FROM NCBI-Organism;

--********************************************************************
--
-- BioSource gives the source of the biological material
--   for sequences
--
--********************************************************************

BioSource ::= SEQUENCE {
    genome INTEGER {		 -- biological context
        unknown (0) ,
        genomic (1) ,
        chloroplast (2) ,
        chromoplast (3) ,
        kinetoplast (4) ,
        mitochondrion (5) ,
        plastid (6) ,
        macronuclear (7) ,
        extrachrom (8) ,
        plasmid (9) ,
        transposon (10) ,
        insertion-seq (11) ,
        cyanelle (12) ,
        proviral (13) ,
        virion (14) ,
        nucleomorph (15) ,
        apicoplast (16) ,
        leucoplast (17) ,
        proplastid (18) ,
        endogenous-virus (19)
      } DEFAULT unknown ,
                                       -- 4 more genome values coming
                                       -- nucleomorph (15)
                                       -- apicoplast (16)
                                       -- leucoplast (17)
                                       -- proplastid (18)
    origin INTEGER {
      unknown (0) ,
      natural (1) ,                    -- normal biological entity
      natmut (2) ,                     -- naturally occurring mutant
      mut (3) ,                        -- artificially mutagenized
      artificial (4) ,                 -- artificially engineered
      synthetic (5) ,                  -- purely synthetic
      other (255) } DEFAULT unknown , 
    org Org-ref ,
    subtype SEQUENCE OF SubSource OPTIONAL ,
    is-focus NULL OPTIONAL }   -- to distinguish biological focus

SubSource ::= SEQUENCE {
    subtype INTEGER {
        chromosome (1) ,
        map (2) ,
        clone (3) ,
        subclone (4) ,
        haplotype (5) ,
        genotype (6) ,
        sex (7) ,
        cell-line (8) ,
        cell-type (9) ,
        tissue-type (10) ,
        clone-lib (11) ,
        dev-stage (12) ,
        frequency (13) ,
        germline (14) ,
        rearranged (15) ,
        lab-host (16) ,
        pop-variant (17) ,
        tissue-lib (18) ,
        plasmid-name (19) ,
        transposon-name (20) ,
        insertion-seq-name (21) ,
        plastid-name (22) ,
        country (23) ,
        segment (24) ,
        endogenous-virus-name (25) ,
        transgenic (26) ,
        environmental-sample (27) ,
        isolation-source (28) ,
        other (255) } ,
    name VisibleString ,
    attrib VisibleString OPTIONAL }    -- attribution/source of this name
        
END

--**********************************************************************
--
--  NCBI Protein
--  by James Ostell, 1990
--  version 0.8
--
--**********************************************************************

NCBI-Protein DEFINITIONS ::=
BEGIN

EXPORTS Prot-ref;

IMPORTS Dbtag FROM NCBI-General;

--*** Prot-ref ***********************************************
--*
--*  Reference to a protein name
--*

Prot-ref ::= SEQUENCE {
    name SET OF VisibleString OPTIONAL ,      -- protein name
    desc VisibleString OPTIONAL ,      -- description (instead of name)
    ec SET OF VisibleString OPTIONAL , -- E.C. number(s)
    activity SET OF VisibleString OPTIONAL ,  -- activities
    db SET OF Dbtag OPTIONAL ,         -- ids in other dbases
    processed ENUMERATED {             -- processing status
       not-set (0) ,
       preprotein (1) ,
       mature (2) ,
       signal-peptide (3) ,
       transit-peptide (4) } DEFAULT not-set }



END 
--********************************************************************
--
--  Transcription Initiation Site Feature Data Block
--  James Ostell, 1991
--  Philip Bucher, David Ghosh
--  version 1.1
--
--  
--
--********************************************************************

NCBI-TxInit DEFINITIONS ::=
BEGIN

EXPORTS Txinit;

IMPORTS Gene-ref FROM NCBI-Gene
        Prot-ref FROM NCBI-Protein
        Org-ref FROM NCBI-Organism;

Txinit ::= SEQUENCE {
    name VisibleString ,    -- descriptive name of initiation site
    syn SEQUENCE OF VisibleString OPTIONAL ,   -- synonyms
    gene SEQUENCE OF Gene-ref OPTIONAL ,  -- gene(s) transcribed
    protein SEQUENCE OF Prot-ref OPTIONAL ,   -- protein(s) produced
    rna SEQUENCE OF VisibleString OPTIONAL ,  -- rna(s) produced
    expression VisibleString OPTIONAL ,  -- tissue/time of expression
    txsystem ENUMERATED {       -- transcription apparatus used at this site
        unknown (0) ,
        pol1 (1) ,      -- eukaryotic Pol I
        pol2 (2) ,      -- eukaryotic Pol II
        pol3 (3) ,      -- eukaryotic Pol III
        bacterial (4) ,
        viral (5) ,
        rna (6) ,       -- RNA replicase
        organelle (7) ,
        other (255) } ,
    txdescr VisibleString OPTIONAL ,   -- modifiers on txsystem
    txorg Org-ref OPTIONAL ,  -- organism supplying transcription apparatus
    mapping-precise BOOLEAN DEFAULT FALSE ,  -- mapping precise or approx
    location-accurate BOOLEAN DEFAULT FALSE , -- does Seq-loc reflect mapping
    inittype ENUMERATED {
        unknown (0) ,
        single (1) ,
        multiple (2) ,
        region (3) } OPTIONAL ,
    evidence SET OF Tx-evidence OPTIONAL }

Tx-evidence ::= SEQUENCE {
    exp-code ENUMERATED {
        unknown (0) ,    
        rna-seq (1) ,   -- direct RNA sequencing
        rna-size (2) ,  -- RNA length measurement
        np-map (3) ,    -- nuclease protection mapping with homologous sequence ladder
        np-size (4) ,   -- nuclease protected fragment length measurement
        pe-seq (5) ,    -- dideoxy RNA sequencing 
        cDNA-seq (6) ,  -- full-length cDNA sequencing
        pe-map (7) ,    -- primer extension mapping with homologous sequence ladder    
        pe-size (8) ,   -- primer extension product length measurement
        pseudo-seq (9) , -- full-length processed pseudogene sequencing
        rev-pe-map (10) ,   -- see NOTE (1) below
        other (255) } ,
    expression-system ENUMERATED {
        unknown (0) ,
        physiological (1) ,
        in-vitro (2) ,
        oocyte (3) ,
        transfection (4) ,
        transgenic (5) ,
        other (255) } DEFAULT physiological ,
    low-prec-data BOOLEAN DEFAULT FALSE ,
    from-homolog BOOLEAN DEFAULT FALSE }     -- experiment actually done on
                                             --  close homolog

    -- NOTE (1) length measurement of a reverse direction primer-extension
    --          product (blocked  by  RNA  5'end)  by  comparison with
    --          homologous sequence ladder (J. Mol. Biol. 199, 587)

    
END

--$Revision: 6.0 $
--**********************************************************************
--
--  NCBI Sequence Alignment elements
--  by James Ostell, 1990
--
--**********************************************************************

NCBI-Seqalign DEFINITIONS ::=
BEGIN

EXPORTS Seq-align, Score, Score-set, Seq-align-set;

IMPORTS Seq-id, Seq-loc , Na-strand FROM NCBI-Seqloc
        Object-id FROM NCBI-General;

--*** Sequence Alignment ********************************
--*

Seq-align-set ::= SET OF Seq-align

Seq-align ::= SEQUENCE {
    type ENUMERATED {
        not-set (0) ,
        global (1) ,
        diags (2) ,		-- unbroken, but not ordered, diagonals
        partial (3) ,           -- mapping pieces together
	disc (4) ,              -- discontinuous alignment
        other (255) } ,
    dim INTEGER OPTIONAL ,     -- dimensionality
    score SET OF Score OPTIONAL ,   -- for whole alignment
    segs CHOICE {                   -- alignment data
        dendiag SEQUENCE OF Dense-diag ,
        denseg Dense-seg ,
        std SEQUENCE OF Std-seg ,
	packed Packed-seg ,
	disc Seq-align-set } ,
    bounds SET OF Seq-loc OPTIONAL }  -- regions of sequence over which align
                                      --  was computed

Dense-diag ::= SEQUENCE {         -- for (multiway) diagonals
    dim INTEGER DEFAULT 2 ,    -- dimensionality
    ids SEQUENCE OF Seq-id ,   -- sequences in order
    starts SEQUENCE OF INTEGER ,  -- start OFFSETS in ids order
    len INTEGER ,                 -- len of aligned segments
    strands SEQUENCE OF Na-strand OPTIONAL ,
    scores SET OF Score OPTIONAL }

    -- Dense-seg: the densist packing for sequence alignments only.
    --            a start of -1 indicates a gap for that sequence of
    --            length lens.
    --
    -- id=100  AAGGCCTTTTAGAGATGATGATGATGATGA
    -- id=200  AAGGCCTTTTAG.......GATGATGATGA
    -- id=300  ....CCTTTTAGAGATGATGAT....ATGA
    --
    -- dim = 3, numseg = 6, ids = { 100, 200, 300 }
    -- starts = { 0,0,-1, 4,4,0, 12,-1,8, 19,12,15, 22,15,-1, 26,19,18 }
    -- lens = { 4, 8, 7, 3, 4, 4 }
    --

Dense-seg ::= SEQUENCE {          -- for (multiway) global or partial alignments
    dim INTEGER DEFAULT 2 ,       -- dimensionality
    numseg INTEGER ,              -- number of segments here
    ids SEQUENCE OF Seq-id ,      -- sequences in order
    starts SEQUENCE OF INTEGER ,  -- start OFFSETS in ids order within segs
    lens SEQUENCE OF INTEGER ,    -- lengths in ids order within segs
    strands SEQUENCE OF Na-strand OPTIONAL ,
    scores SEQUENCE OF Score OPTIONAL }  -- score for each seg

Packed-seg ::= SEQUENCE {         -- for (multiway) global or partial alignments
    dim INTEGER DEFAULT 2 ,       -- dimensionality
    numseg INTEGER ,              -- number of segments here
    ids SEQUENCE OF Seq-id ,      -- sequences in order
    starts SEQUENCE OF INTEGER ,  -- start OFFSETS in ids order for whole alignment
    present OCTET STRING ,        -- Boolean if each sequence present or absent in
                                  --   each segment
    lens SEQUENCE OF INTEGER ,    -- length of each segment
    strands SEQUENCE OF Na-strand OPTIONAL ,
    scores SEQUENCE OF Score OPTIONAL }  -- score for each segment

Std-seg ::= SEQUENCE {
    dim INTEGER DEFAULT 2 ,       -- dimensionality
    ids SEQUENCE OF Seq-id OPTIONAL ,
    loc SEQUENCE OF Seq-loc ,
    scores SET OF Score OPTIONAL }

-- use of Score is discouraged for external ASN.1 specifications
Score ::= SEQUENCE {
    id Object-id OPTIONAL ,
    value CHOICE {
        real REAL ,
        int INTEGER  } }

-- use of Score-set is encouraged for external ASN.1 specifications
Score-set ::= SET OF Score

END 

--$Revision: 6.0 $
--**********************************************************************
--
--  NCBI Sequence Analysis Results (other than alignments)
--  by James Ostell, 1990
--
--**********************************************************************

NCBI-Seqres DEFINITIONS ::=
BEGIN

EXPORTS Seq-graph;

IMPORTS Seq-loc FROM NCBI-Seqloc;

--*** Sequence Graph ********************************
--*
--*   for values mapped by residue or range to sequence
--*

Seq-graph ::= SEQUENCE {
    title VisibleString OPTIONAL ,
    comment VisibleString OPTIONAL ,
    loc Seq-loc ,                       -- region this applies to
    title-x VisibleString OPTIONAL ,    -- title for x-axis
    title-y VisibleString OPTIONAL ,
    comp INTEGER OPTIONAL ,             -- compression (residues/value)
    a REAL OPTIONAL ,                   -- for scaling values
    b REAL OPTIONAL ,                   -- display = (a x value) + b
    numval INTEGER ,                    -- number of values in graph
    graph CHOICE {
        real Real-graph ,
        int Int-graph ,
        byte Byte-graph } }

Real-graph ::= SEQUENCE {
    max REAL ,                          -- top of graph
    min REAL ,                          -- bottom of graph
    axis REAL ,                         -- value to draw axis on
    values SEQUENCE OF REAL }

Int-graph ::= SEQUENCE {
    max INTEGER ,
    min INTEGER ,
    axis INTEGER ,
    values SEQUENCE OF INTEGER } 

Byte-graph ::= SEQUENCE {              -- integer from 0-255
    max INTEGER ,
    min INTEGER ,
    axis INTEGER ,
    values OCTET STRING }

END

--$Revision: 6.1 $
--********************************************************************
--
--  Direct Submission of Sequence Data
--  James Ostell, 1991
--
--  This is a trial specification for direct submission of sequence
--    data worked out between NCBI and EMBL
--  Later revised to reflect work with GenBank and Integrated database
--
--  Version 3.0, 1994
--    This is the official NCBI sequence submission format now.
--
--********************************************************************

NCBI-Submit DEFINITIONS ::=
BEGIN

EXPORTS Seq-submit, Contact-info;

IMPORTS Cit-sub, Author FROM NCBI-Biblio
        Date, Object-id FROM NCBI-General
        Seq-annot FROM NCBI-Sequence
        Seq-id FROM NCBI-Seqloc
        Seq-entry FROM NCBI-Seqset;

Seq-submit ::= SEQUENCE {
    sub Submit-block ,
    data CHOICE {
        entrys  SET OF Seq-entry ,  -- sequence(s)
        annots  SET OF Seq-annot ,  -- annotation(s)
        delete  SET OF Seq-id } } -- deletions of entries

Submit-block ::= SEQUENCE {
    contact Contact-info ,        -- who to contact
    cit Cit-sub ,                 -- citation for this submission
    hup BOOLEAN DEFAULT FALSE ,   -- hold until publish
    reldate Date OPTIONAL ,       -- release by date
    subtype INTEGER {             -- type of submission
        new (1) ,                 -- new data
        update (2) ,              -- update by author
        revision (3) ,            -- 3rd party (non-author) update
        other (255) } OPTIONAL ,
    tool VisibleString OPTIONAL,  -- tool used to make submission
    user-tag VisibleString OPTIONAL, -- user supplied id for this submission
    comment VisibleString OPTIONAL } -- user comments/advice to database

Contact-info ::= SEQUENCE {      -- who to contact to discuss the submission
    name VisibleString OPTIONAL ,        -- OBSOLETE: will be removed
    address SEQUENCE OF VisibleString OPTIONAL ,
    phone VisibleString OPTIONAL ,
    fax VisibleString OPTIONAL ,
    email VisibleString OPTIONAL ,
    telex VisibleString OPTIONAL ,
    owner-id Object-id OPTIONAL ,         -- for owner accounts
    password OCTET STRING OPTIONAL ,
    last-name VisibleString OPTIONAL ,  -- structured to replace name above
    first-name VisibleString OPTIONAL ,
    middle-initial VisibleString OPTIONAL ,
    contact Author OPTIONAL }           -- WARNING: this will replace the above

END

--$Revision: 1.11 $
--**********************************************************************
--
--  Definitions for Cn3D-specific data (rendering settings,
--    user annotations, etc.)
--
--  by Paul Thiessen
--
--  National Center for Biotechnology Information
--  National Institutes of Health
--  Bethesda, MD 20894 USA
--
-- asntool -m cn3d.asn -w 100 -o cn3d.h
-- asntool -B objcn3d -m cn3d.asn -G -w 100 -K cn3d.h -I mapcn3d.h \
--   -M ../mmdb1.asn,../mmdb2.asn,../mmdb3.asn
--**********************************************************************

NCBI-Cn3d DEFINITIONS ::=
-- Cn3D-specific information

BEGIN

EXPORTS  Cn3d-style-dictionary, Cn3d-user-annotations;

IMPORTS  Biostruc-id FROM MMDB
         Molecule-id, Residue-id FROM MMDB-Chemical-graph;


-- values of enumerations must match those in cn3d/style_manager.hpp!

Cn3d-backbone-type ::= ENUMERATED {     -- for different types of backbones
    off (1),
    trace (2),
    partial (3),
    complete (4)
}

Cn3d-drawing-style ::= ENUMERATED {     -- atom/bond/object rendering styles
    -- for atoms and bonds
    wire (1),
    tubes (2),
    ball-and-stick (3),
    space-fill (4),
    wire-worm (5),
    tube-worm (6),
    -- for 3d-objects
    with-arrows (7),
    without-arrows (8)
}

Cn3d-color-scheme ::= ENUMERATED {  -- available color schemes (not all
                                    -- necessarily applicable to all objects)
    element (1),
    object (2),
    molecule (3),
    domain (4),
    secondary-structure (5),
    user-select (6),
    -- different alignment conservation coloring (currently only for proteins)
    aligned (7),
    identity (8),
    variety (9),
    weighted-variety (10),
    information-content (11),
    fit (12),
    -- other schemes
    temperature (13),
    hydrophobicity (14),
    charge (15),
    rainbow (16)
}

-- RGB triplet, interpreted (after division by the scale-factor) as floating
-- point values which should range from [0..1]. The default scale-factor is
-- 255, so that one can conveniently set integer byte values [0..255] for
-- colors with the scale-factor already set appropriately to map to [0..1].
--    An alpha value is allowed, but is currently ignored by Cn3D.
Cn3d-color ::= SEQUENCE {
    scale-factor INTEGER DEFAULT 255,
    red INTEGER,
    green INTEGER,
    blue INTEGER,
    alpha INTEGER DEFAULT 255
}

Cn3d-backbone-style ::= SEQUENCE {  -- style blob for backbones only
    type Cn3d-backbone-type,
    style Cn3d-drawing-style,
    color-scheme Cn3d-color-scheme,
    user-color Cn3d-color
}

Cn3d-general-style ::= SEQUENCE {   -- style blob for other objects
    is-on BOOLEAN,
    style Cn3d-drawing-style,
    color-scheme Cn3d-color-scheme,
    user-color Cn3d-color
}

Cn3d-backbone-label-style ::= SEQUENCE { -- style blob for backbone labels
    spacing INTEGER,        -- zero means none
    type ENUMERATED {
        one-letter (1),
        three-letter (2)
    },
    number ENUMERATED {
        none (0),
        sequential (1),     -- from 1, by residues present, to match sequence
        pdb (2)             -- use number assigned by PDB
    },
    termini BOOLEAN,
    white BOOLEAN           -- all white, or (if false) color of alpha carbon
}

-- rendering settings for Cn3D (mirrors StyleSettings class)
Cn3d-style-settings ::= SEQUENCE {
    name VisibleString OPTIONAL,                -- a name (for favorites)
    protein-backbone Cn3d-backbone-style,       -- backbone styles
    nucleotide-backbone Cn3d-backbone-style,
    protein-sidechains Cn3d-general-style,      -- styles for other stuff
    nucleotide-sidechains Cn3d-general-style,
    heterogens Cn3d-general-style,
    solvents Cn3d-general-style,
    connections Cn3d-general-style,
    helix-objects Cn3d-general-style,
    strand-objects Cn3d-general-style,
    virtual-disulfides-on BOOLEAN,              -- virtual disulfides
    virtual-disulfide-color Cn3d-color,
    hydrogens-on BOOLEAN,                       -- hydrogens
    background-color Cn3d-color,                -- background
    -- floating point parameters - scale-factor applies to all the following:
    scale-factor INTEGER,
    space-fill-proportion INTEGER,
    ball-radius INTEGER,
    stick-radius INTEGER,
    tube-radius INTEGER,
    tube-worm-radius INTEGER,
    helix-radius INTEGER,
    strand-width INTEGER,
    strand-thickness INTEGER,
    -- backbone labels (no labels if not present)
    protein-labels Cn3d-backbone-label-style OPTIONAL,
    nucleotide-labels Cn3d-backbone-label-style OPTIONAL,
    -- ion labels
    ion-labels BOOLEAN OPTIONAL
}

Cn3d-style-settings-set ::= SET OF Cn3d-style-settings

Cn3d-style-table-id ::= INTEGER

Cn3d-style-table-item ::= SEQUENCE {
    id Cn3d-style-table-id,
    style Cn3d-style-settings
}

-- the global settings, and a lookup table of styles for user annotations.
Cn3d-style-dictionary ::= SEQUENCE {
    global-style Cn3d-style-settings,
    style-table SEQUENCE OF Cn3d-style-table-item OPTIONAL
}

-- a range of residues in a chain, identified by MMDB residue-id
-- (e.g., numbered from 1)
Cn3d-residue-range ::= SEQUENCE {
    from Residue-id,
    to Residue-id
}

-- set of locations on a particular chain
Cn3d-molecule-location ::= SEQUENCE {
    molecule-id Molecule-id,    -- MMDB molecule id
    -- which residues; whole molecule implied if absent
    residues SEQUENCE OF Cn3d-residue-range OPTIONAL
}

-- set of locations on a particular structure object (e.g., a PDB/MMDB
-- structure), which may include multiple ranges of residues each on
-- multiple chains.
Cn3d-object-location ::= SEQUENCE {
    structure-id Biostruc-id,
    residues SEQUENCE OF Cn3d-molecule-location
}

-- information for an individual user annotation
Cn3d-user-annotation ::= SEQUENCE {
    name VisibleString,                 -- a (short) name for this annotation
    description VisibleString OPTIONAL, -- an optional longer description
    style-id Cn3d-style-table-id,       -- how to draw this annotation
    residues SEQUENCE OF Cn3d-object-location,  -- which residues to cover
    is-on BOOLEAN   -- whether this annotation is to be turned on in Cn3D
}

-- a GL-ordered transformation matrix
Cn3d-GL-matrix ::= SEQUENCE {
    m0  REAL, m1  REAL, m2  REAL, m3  REAL,
    m4  REAL, m5  REAL, m6  REAL, m7  REAL,
    m8  REAL, m9  REAL, m10 REAL, m11 REAL,
    m12 REAL, m13 REAL, m14 REAL, m15 REAL
}

-- a floating point 3d vector
Cn3d-vector ::= SEQUENCE {
    x REAL,
    y REAL,
    z REAL
}

-- parameters used to set up the camera in Cn3D
Cn3d-view-settings ::= SEQUENCE {
    camera-distance REAL,       -- camera on +Z axis this distance from origin
    camera-angle-rad REAL,      -- camera angle
    camera-look-at-X REAL,      -- X,Y of point in Z=0 plane camera points at
    camera-look-at-Y REAL,
    camera-clip-near REAL,      -- distance of clipping planes from camera
    camera-clip-far REAL,
    matrix Cn3d-GL-matrix,      -- transformation of objects in the scene
    rotation-center Cn3d-vector -- center of rotation of whole scene
}

-- The list of annotations for a given CDD/mime. If residue regions overlap
-- between annotations that are turned on, the last annotation in this list
-- that contains these residues will be used as the display style for these
-- residues.
--   Also contains the current viewpoint, so that user's camera angle
-- can be stored and reproduced, for illustrations, on-line figures, etc.
Cn3d-user-annotations ::= SEQUENCE {
    annotations SEQUENCE OF Cn3d-user-annotation OPTIONAL,
    view Cn3d-view-settings OPTIONAL
}

END

--$Revision: 6.3 $
--****************************************************************
--
--  NCBI Project Definition Module
--  by Jim Ostell and Jonathan Kans, 1998
--
--****************************************************************

NCBI-Project DEFINITIONS ::=
BEGIN

EXPORTS Project, Project-item;

IMPORTS Date FROM NCBI-General
        PubMedId FROM NCBI-Biblio
        Seq-id, Seq-loc FROM NCBI-Seqloc
        Seq-annot, Pubdesc FROM NCBI-Sequence
        Seq-entry FROM NCBI-Seqset
        Pubmed-entry FROM NCBI-PubMed;

Project ::= SEQUENCE {
    descr Project-descr OPTIONAL ,
    data Project-item }

Project-item ::= CHOICE {
    pmuid SET OF INTEGER ,
    protuid SET OF INTEGER ,
    nucuid SET OF INTEGER ,
    sequid SET OF INTEGER ,
    genomeuid SET OF INTEGER ,
    structuid SET OF INTEGER ,
    pmid SET OF PubMedId ,
    protid SET OF Seq-id ,
    nucid SET OF Seq-id ,
    seqid SET OF Seq-id ,
    genomeid SET OF Seq-id ,
    structid NULL ,
    pment SET OF Pubmed-entry ,
    protent SET OF Seq-entry ,
    nucent SET OF Seq-entry ,
    seqent SET OF Seq-entry ,
    genomeent SET OF Seq-entry ,
    structent NULL ,
    seqannot SET OF Seq-annot ,
    loc SET OF Seq-loc ,
    proj SET OF Project
}

Project-descr ::= SEQUENCE {
    id SET OF Project-id ,
    name VisibleString OPTIONAL ,
    descr SET OF Projdesc OPTIONAL }

Projdesc ::= CHOICE {
    pub Pubdesc ,
    date Date ,
    comment VisibleString ,
    title VisibleString
}

Project-id ::= VisibleString

END


--$Revision: 6.0 $
--*********************************************************************
--
--  access.asn
--
--     messages for data access
--
--*********************************************************************

NCBI-Access DEFINITIONS ::=
BEGIN

EXPORTS Link-set;

    -- links between same class = neighbors
    -- links between other classes = links

Link-set ::= SEQUENCE {
    num INTEGER ,                         -- number of links to this doc type
    uids SEQUENCE OF INTEGER OPTIONAL ,     -- the links
    weights SEQUENCE OF INTEGER OPTIONAL }  -- the weights


END
--$Revision: 6.0 $
--**********************************************************************
--
--  NCBI Sequence Feature Definition Module
--  by James Ostell, 1994
--
--**********************************************************************

NCBI-FeatDef DEFINITIONS ::=
BEGIN

EXPORTS FeatDef, FeatDefSet, FeatDispGroup, FeatDispGroupSet;


FeatDef ::= SEQUENCE {
    typelabel VisibleString ,	   -- short label for type eg "CDS"
    menulabel VisibleString ,	   -- label for a menu eg "Coding Region"
    featdef-key INTEGER ,		   -- unique for this feature definition
    seqfeat-key INTEGER ,		   -- SeqFeat.data.choice from objfeat.h
    entrygroup INTEGER ,		   -- Group for data entry
    displaygroup INTEGER ,		   -- Group for data display
    molgroup FeatMolType           -- Type of Molecule used for
}

FeatMolType ::= ENUMERATED {
	aa (1),  -- proteins
    na (2),  -- nucleic acids
    both (3) }  -- both

FeatDefSet ::= SEQUENCE OF FeatDef   -- collections of defintions

FeatDispGroup ::= SEQUENCE {
	groupkey INTEGER ,
    groupname VisibleString }

FeatDispGroupSet ::= SEQUENCE OF FeatDispGroup

FeatDefGroupSet ::= SEQUENCE {
	groups FeatDispGroupSet ,
	defs FeatDefSet }

END

    
--$Revision: 6.12 $
--****************************************************************
--
--  NCBI MIME type (chemical/ncbi-asn1-ascii and chemical/ncbi-asn1-binary)
--  by Jonathan Epstein, February 1996
--
--****************************************************************

NCBI-Mime DEFINITIONS ::=
BEGIN

EXPORTS Ncbi-mime-asn1;
IMPORTS Biostruc, Biostruc-annot-set FROM MMDB
    Cdd FROM NCBI-Cdd
	Seq-entry FROM NCBI-Seqset
	Seq-annot FROM NCBI-Sequence
    Medline-entry FROM NCBI-Medline
    Cn3d-style-dictionary, Cn3d-user-annotations FROM NCBI-Cn3d;

Ncbi-mime-asn1 ::= CHOICE {
	entrez	Entrez-general,			-- just a structure
    alignstruc  Biostruc-align,     -- structures & sequences & alignments
	alignseq	Biostruc-align-seq,	-- sequence alignment
    strucseq    Biostruc-seq,       -- structure & sequences
    strucseqs   Biostruc-seqs,      -- structure & sequences & alignments
    general     Biostruc-seqs-aligns-cdd    -- all-purpose "grab bag"
	-- others may be added here in the future
}

-- generic bundle of sequence and alignment info
Bundle-seqs-aligns ::= SEQUENCE {
    sequences SET OF Seq-entry OPTIONAL,        -- sequences
    seqaligns SET OF Seq-annot OPTIONAL,        -- sequence alignments
    strucaligns Biostruc-annot-set OPTIONAL,    -- structure alignments
    imports SET OF Seq-annot OPTIONAL,          -- imports (updates in Cn3D)
    style-dictionary Cn3d-style-dictionary OPTIONAL,    -- Cn3D stuff
    user-annotations Cn3d-user-annotations OPTIONAL
}

Biostruc-seqs-aligns-cdd ::= SEQUENCE {
    seq-align-data CHOICE {
        bundle Bundle-seqs-aligns,          -- either seqs + alignments
        cdd Cdd                             -- or CDD (which contains these)
    },
    structures SET OF Biostruc OPTIONAL,    -- structures
    structure-type ENUMERATED {             -- type of structures to load if
        ncbi-backbone(2),                   -- not present; meanings and
        ncbi-all-atom(3),                   -- values are same as MMDB's
        pdb-model(4)                        -- Model-type
    } OPTIONAL
}

Biostruc-align ::= SEQUENCE {
	master	Biostruc,
	slaves	SET OF Biostruc,
	alignments	Biostruc-annot-set,	-- structure alignments
	sequences SET OF Seq-entry,	-- sequences
	seqalign SET OF Seq-annot,
	style-dictionary Cn3d-style-dictionary OPTIONAL,
	user-annotations Cn3d-user-annotations OPTIONAL
}

Biostruc-align-seq ::= SEQUENCE {	-- display seq structure align only
	sequences SET OF Seq-entry,	-- sequences
	seqalign SET OF Seq-annot,
	style-dictionary Cn3d-style-dictionary OPTIONAL,
	user-annotations Cn3d-user-annotations OPTIONAL
}

Biostruc-seq ::= SEQUENCE {	-- display  structure seq added by yanli
	structure Biostruc,
	sequences SET OF Seq-entry,
	style-dictionary Cn3d-style-dictionary OPTIONAL,
	user-annotations Cn3d-user-annotations OPTIONAL
}

Biostruc-seqs ::= SEQUENCE { -- display blast alignment along with neighbor's structure added by yanli
	structure Biostruc,
	sequences SET OF Seq-entry,	-- sequences
	seqalign SET OF Seq-annot,
	style-dictionary Cn3d-style-dictionary OPTIONAL,
	user-annotations Cn3d-user-annotations OPTIONAL
}

Entrez-style ::= ENUMERATED {
	docsum (1),
	genbank (2) ,
	genpept (3) ,
	fasta (4) ,
	asn1 (5) ,
	graphic (6) ,
	alignment (7) ,
	globalview (8) ,
	report (9) ,
	medlars (10) ,
	embl (11) ,
	pdb (12) ,
	kinemage (13) }

Entrez-general ::= SEQUENCE {
	title VisibleString OPTIONAL,
	data CHOICE {
		ml	Medline-entry ,
		prot	Seq-entry ,
		nuc	Seq-entry ,
		genome	Seq-entry ,
		structure Biostruc ,
		strucAnnot Biostruc-annot-set } ,
	style Entrez-style ,
	location VisibleString OPTIONAL }
END
--$Revision: 6.0 $
--********************************************************************
--
--  Print Templates
--  James Ostell, 1993
--
--
--********************************************************************

NCBI-ObjPrt DEFINITIONS ::=
BEGIN

EXPORTS PrintTemplate, PrintTemplateSet;

PrintTemplate ::= SEQUENCE {
    name TemplateName ,  -- name for this template
    labelfrom VisibleString OPTIONAL,    -- ASN.1 path to get label from
    format PrintFormat }

TemplateName ::= VisibleString

PrintTemplateSet ::= SEQUENCE OF PrintTemplate

PrintFormat ::= SEQUENCE {
    asn1 VisibleString ,    -- ASN.1 partial path for this
    label VisibleString OPTIONAL ,   -- printable label
    prefix VisibleString OPTIONAL,
    suffix VisibleString OPTIONAL,
    form PrintForm }

PrintForm ::=   CHOICE {      -- Forms for various ASN.1 components
    block PrintFormBlock,
    boolean PrintFormBoolean,
    enum PrintFormEnum,
    text PrintFormText,
    use-template TemplateName,
    user UserFormat ,
    null NULL }               -- rarely used

UserFormat ::= SEQUENCE {
    printfunc VisibleString ,
    defaultfunc VisibleString OPTIONAL }

PrintFormBlock ::= SEQUENCE {  -- for SEQUENCE, SET
    separator VisibleString OPTIONAL ,
    components SEQUENCE OF PrintFormat }

PrintFormBoolean ::= SEQUENCE {
    true VisibleString OPTIONAL ,
    false VisibleString OPTIONAL }

PrintFormEnum ::= SEQUENCE {
    values SEQUENCE OF VisibleString OPTIONAL }

PrintFormText ::= SEQUENCE {
    textfunc VisibleString OPTIONAL }
    
END